User: Marc Noguera

gravatar for Marc Noguera
Marc Noguera100
Reputation:
100
Status:
New User
Location:
Last seen:
9 years, 1 month ago
Joined:
9 years, 9 months ago
Email:
m*******@imppc.org

Posts by Marc Noguera

<prev • 10 results • page 1 of 1 • next >
0
votes
1
answer
591
views
1
answers
Comment: C: fastq upload time
... If you want to check quality, and base-position/frequency I would suggest random sampling on the fastq file to extract let's say a 5-10% of the file and run Quality analysis on it. Though global numbers won't be real most of the information will be still informative with less memory/CPU. I wrote s ...
written 9.1 years ago by Marc Noguera100
0
votes
2
answers
1.5k
views
2
answers
Coverage vs GC bias - how to?
... Hi all, I am trying to get some insight knowledge on some NGS data. I have an alignment file and an AlignedRead object from it, from which I can compute coverage. What I would like to know is if there is any bias on the coverage vs GC content. My idea is to run a sliding window of width N through t ...
coverage bsgenome iranges written 9.1 years ago by Marc Noguera100 • updated 9.1 years ago by Harris A. Jaffee590
0
votes
4
answers
928
views
4
answers
Answer: A: downloading different kinds of microarray data
... Hi all, I have been learning to use ChIPpeakAnno package to annotate the peaks I obtain with CHiPseq experimetns. I see that, useing biomaRt, i can get to some annotation on ensembl and annotate the peaks according to TSS, exon, miRNA and some other features. I would like, also, to be able to search ...
written 9.2 years ago by Marc Noguera100
0
votes
2
answers
1.3k
views
2
answers
Comment: C: Problem with bnlearn and Rgraphviz
... Thanks for the detailed explanation. I have tried as indicated, as some other things. Just for the record: > entrez<-mget(annotatedPeaks$feature,org.Mm.egENSEMBL2EG,ifnotfound=NA) > entrez[1:3] $ENSMUSG00000025907 [1] "12421" $ENSMUSG00000061518 [1] "12859" "100046079" $ENSMUSG000000 ...
written 9.2 years ago by Marc Noguera100
0
votes
2
answers
1.3k
views
2
answers
Comment: C: Problem with bnlearn and Rgraphviz
... My explanation wasn't quite clear, excuse me. I have a RangedData object, as obtained from ChipPeakAnno, with lots of peaks which are annotated like this: >table <- read.table("H3K4me3vsIgG_peaks.bed") >bed <- BED2RangedData(bed,header=T) >annotatedPeaks<-annotatePeakInBatch(bed, ...
written 9.2 years ago by Marc Noguera100
0
votes
2
answers
1.3k
views
2
answers
Answer: A: Problem with bnlearn and Rgraphviz
... Hi all, this may be a very naive question by I have been trying to solve it myself and i can't get through it. I have this RangedData object obtained from ChIPpeakAnno Package, which correspond toa Chipseq experiment with annotated peaks, with ENSEMBL identificators. I can use this output already ...
written 9.2 years ago by Marc Noguera100
0
votes
1
answer
624
views
1
answers
Comment: C: within array normalization for one color agilent array.??
... Hi all, I am trying to read and visualize data obtained from an agilent chip. For this purpose I use limma package and the read.maimages function as follows fileRG.raw <- read.maimages("File",source="agilent") FileRG gets read correctly. When I check the dimensions it shows to have 243494 prob ...
written 9.7 years ago by Marc Noguera100
0
votes
1
answer
469
views
1
answer
ShortRead - readAligned() with bowtie & qual
... Dear list, I am trying to do some quality assessment on solexa runs using Bioc&shortreads. I am using bowtie as a mapper, which yields bowtie-formatted output with fastq scores for alignment, such as: > HWUSI-EAS621_91022_1_100_1938_1667 + chr15 53573544 > CAGTCTCCCAAAGTACTGGGATAATAGGT ...
alignment written 9.8 years ago by Marc Noguera100 • updated 9.8 years ago by Kasper Daniel Hansen6.4k
0
votes
4
answers
614
views
4
answers
Comment: C: (no subject)
... Thanks for the help Sean, It has been very useful. I have managed to create the geneUniverse from chip data and run the hyperGTests on my selected genesets looking for enrichment. Now I have hyperGResults instances as a result, and apart from summary information on MF, BP or CC with the correspondin ...
written 9.8 years ago by Marc Noguera100
0
votes
4
answers
614
views
4
answers
Answer: A: (no subject)
... Dear list, I am trying to find function enrichment for a gene list that we have obtained through chip-chip experiments. The chip that we have used is the Agilent human promoter array, which consists of two differents slides. I cannot find any package corresponding to the annotation of this chip, whi ...
written 9.8 years ago by Marc Noguera100

Latest awards to Marc Noguera

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 416 users visited in the last hour