User: Erik Wright

gravatar for Erik Wright
Erik Wright210
Reputation:
210
Status:
Trusted
Location:
Last seen:
7 years, 9 months ago
Joined:
9 years, 8 months ago
Email:
e*******@wisc.edu

Posts by Erik Wright

<prev • 21 results • page 1 of 3 • next >
0
votes
1
answer
642
views
1
answers
Comment: C: Biostrings - pairwiseAlignment trimmed pattern returned
... Thanks Valerie, Your explanation was much better than the one I found in the ?pairwiseAlignment man page. It states: "global" = align whole strings with end gap penalties ... "global- local" = align whole strings in pattern with consecutive subsequence of subject Obviously the "whole strings" wer ...
written 7.8 years ago by Erik Wright210
0
votes
1
answer
642
views
1
answer
Biostrings - pairwiseAlignment trimmed pattern returned
... Hello, I have been using the Biostrings function "pairwiseAlignment" lately to perform sequence alignments. I have discovered that with difficult alignments it sometimes returns incomplete patterns. For example: pairwiseAlignment("ACTGACTGACTGACTG","AAGAAGAGTTATGGGAGTAACTGACC") Global PairwiseAl ...
alignment biostrings written 7.8 years ago by Erik Wright210 • updated 7.8 years ago by Valerie Obenchain6.7k
0
votes
1
answer
921
views
1
answers
Comment: C: Difficulties updating Biostrings on Ubuntu
... Hi Benilton, Yes, all I need to do was upgrade R. Apparently the CRAN mirror I was using no longer exists, so apt-get updates were not occurring automatically and I never noticed. Thanks, Erik On Aug 21, 2010, at 9:05 PM, Benilton Carvalho wrote: > You should start by upgrading R. > > ...
written 9.3 years ago by Erik Wright210
0
votes
1
answer
921
views
1
answer
Difficulties updating Biostrings on Ubuntu
... Hello, I am attempting to upgrade the Biostrings package on a linux box running Ubuntu (10.04). If I use: > source("http://bioconductor.org/biocLite.R") > biocLite("Biostrings") Afterwards the computer still has the same (presumably outdated) version (2.14.12). So I tried installing the dev ...
biostrings written 9.3 years ago by Erik Wright210 • updated 9.3 years ago by Benilton Carvalho4.3k
0
votes
2
answers
1.3k
views
2
answers
Comment: C: Biostrings - vcountPattern optimization
... Hi Patrick, Thanks, this looks promising. Three possible complications are: (1) The fragments are not all the same width. Is this possible with Pdict? (2) I allow a variable number of mismatches based on each individual fragment's width. (3) The fragments sometimes include ambiguity letters (I ...
written 9.4 years ago by Erik Wright210
0
votes
2
answers
1.3k
views
2
answers
Biostrings - vcountPattern optimization
... Hello, Lately I have been working on counting sequence fragments in larger sets of sequences. I am searching for thousands of fragments of 30 to 130 bases in hundreds of thousands of sequences between 1200 and 1600 bases. Currently I am using the following method to count the number of "hits": # ...
written 9.4 years ago by Erik Wright210 • updated 9.4 years ago by Patrick Aboyoun1.6k
0
votes
1
answer
673
views
1
answer
Biostrings - size limits
... Hello, What limits the number of sequences and size of sequences that are part of a DNAStringSet? Are there any way to change these limits? On my home laptop I can create a DNAStringSet of about sixty thousand sequences of length 1500. On my desktop I can only make a DNAStringSet of twenty thous ...
written 9.5 years ago by Erik Wright210 • updated 9.5 years ago by Steve Lianoglou12k
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Alignment viewer?
... Very good idea! Thanks Thomas! On May 4, 2010, at 4:30 PM, Thomas Girke wrote: > If it helps, here are a few examples for handling multiple/pairwise > alignments in Biostring's XStringSet container class and viewing them as > html files in a browser (StringSet2html): > http://manuals ...
written 9.6 years ago by Erik Wright210
0
votes
1
answer
1.5k
views
7 follow
1
answer
Alignment viewer?
... Hi all, Does anyone know of a package that I can use to view alignments in R? Basically I want to display a long DNAStringSet sequence by sequence: Seq1: ACTAGGAGCTYA... Seq2: ACTACGAGCTCA... Seq3: ACTAGGACCTNA... etc.... I just wanted to check if there is one already available so that I don't ...
go written 9.6 years ago by Erik Wright210 • updated 9.6 years ago by Thomas Girke1.7k
0
votes
2
answers
882
views
2
answers
Comment: C: consensusString Function
... Hi Patrick, Thanks for closing the loop on this issue. I have a question about the outputs you show below: If two strings are ACAG and ACAR where R can be A or G, then it makes sense to me that the consensus is ACAR. Why then is an N treated differently than an R? If two strings are NNNN and AC ...
written 9.7 years ago by Erik Wright210

Latest awards to Erik Wright

Popular Question 7.8 years ago, created a question with more than 1,000 views. For Alignment viewer?
Popular Question 7.8 years ago, created a question with more than 1,000 views. For Biostrings - vcountPattern optimization

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 392 users visited in the last hour