The support.bioconductor.org editor has been updated to markdown! Please see more info at: Tutorial: Updated Support Site Editor

User: Dawid G. Nowak

Reputation:
10
Status:
New User
Location:
United States
Twitter:
@NowakDG
Last seen:
1 day, 22 hours ago
Joined:
4 years, 4 months ago
Email:
d************@gmail.com

Posts by Dawid G. Nowak

<prev • 27 results • page 1 of 3 • next >
0
votes
3
answers
86
views
3
answers
Comment: C: CRISPRseek Unusual Error
... Julie, Thank you for finding this exception! I think your solution sounds good. As a side questions 1) Can "Hsu-Zhang" scoring handle this type of mismatches? 2) Can "chromToExclude =" exclude specific sequence on the chromosome i.e. chr1:171,228,616-171,228,638 Thanks, Dawid ...
written 2 days ago by Dawid G. Nowak10
0
votes
3
answers
86
views
3
answers
Comment: C: CRISPRseek Unusual Error
... # mouse db library(BSgenome.Mmusculus.UCSC.mm10) library(TxDb.Mmusculus.UCSC.mm10.knownGene) library(org.Mm.eg.db) orgAnn <- get("org.Mm.egSYMBOL") BSgenomeName <- get("Mmusculus") txdb <- get("TxDb.Mmusculus.UCSC.mm10.knownGene") # code offTargetAn ...
written 2 days ago by Dawid G. Nowak10
0
votes
3
answers
86
views
3
answers
Comment: C: CRISPRseek Unusual Error
... Julie, I was not clear that my test was in mouse. I see you tested for human. Thanks, Dawid ...
written 2 days ago by Dawid G. Nowak10
0
votes
3
answers
86
views
3
answers
Comment: C: CRISPRseek Unusual Error
... Julie, Thank for your reply. Removing foldgRNA didn't work. When I run only i.e. chromToSearch= "chr19" everything works fine. Below sequence that tested: > rightseq gcggcaggccctccgagcgtggtggagccgttctgtgagacagccgggtacgagtcgtgacgctggaaggggcaagcgggtggtgggcaggaatgcggtccgccctgcagcaaccggag ...
written 4 days ago by Dawid G. Nowak10
3
votes
3
answers
86
views
3
answers
CRISPRseek Unusual Error
... Hi, I am getting this error below and Summary and Off-targets file are not created. I would appreciate any suggestion. Thanks, Dawid Building feature vectors for scoring ... Calculating scores ... Error in `$<-.data.frame`(`*tmp*`, "score", value = c(0.0112619406241216, : r ...
crisprseek written 4 days ago by Dawid G. Nowak10 • updated 1 day ago by Julie Zhu3.9k
0
votes
1
answer
235
views
1
answers
Comment: C: CFDscore calculations used in CRISPRseek
... Hi Julie,  I tested again, it seems to give me this error below when I test 2x mappable guides and 1x unmappable guide (Everything works when there is 1x mappable guide and 1x unmappable) Error in discover_repository(path) : Error in 'git2r_repository_discover': 'path' must be a character vect ...
written 10 weeks ago by Dawid G. Nowak10
0
votes
1
answer
235
views
1
answers
Comment: C: CFDscore calculations used in CRISPRseek
... Thanks Julie, I tested quickly, interestingly when I have 1x mappable guide and 1x unmappable guide it seems to work (summary file has both), but when I have 2x mappable guides and 1x unmappable it seems to skip unmappable again in summary file. I run these guides below:   >neg01_unmappable GT ...
written 10 weeks ago by Dawid G. Nowak10
0
votes
1
answer
235
views
1
answers
Comment: C: CFDscore calculations used in CRISPRseek
... Hi Julie, I used max.mismatch = 3 and in Summary.xls guide (>neg01) is skipped, even after using CRISPRseek_1.23.1. Dawid   ...
written 11 weeks ago by Dawid G. Nowak10
0
votes
1
answer
235
views
1
answers
Comment: C: CFDscore calculations used in CRISPRseek
... Julie, Thanks for your reply, I think that could be also applied when you have a targeting guide but it doesn't have off-targets (at least based on the scoring system).  Dawid ...
written 11 weeks ago by Dawid G. Nowak10
0
votes
1
answer
235
views
1
answers
Comment: C: CFDscore calculations used in CRISPRseek
... Hi Julie, I was testing non-targeting guides for human. I'm interested in to compare different scoring methods and how they score with guides that shouldn't target i.e. human genome, example here: # guide >neg01 GTAGCGAACGTGTCCGGCGT # code offTargetAnalysis(inputFilePath, REpatternFile = RE ...
written 11 weeks ago by Dawid G. Nowak10

Latest awards to Dawid G. Nowak

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 266 users visited in the last hour