User: jeremyatwsu

gravatar for jeremyatwsu
Reputation:
0
Status:
New User
Last seen:
4 years, 12 months ago
Joined:
5 years ago
Email:
j**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by jeremyatwsu

<prev • 6 results • page 1 of 1 • next >
0
votes
4
answers
1.2k
views
4
answers
Comment: C: CRISPRseek for Arabidopsis
... That is great: it works!  Thank you so much for your help!   ...
written 5.0 years ago by jeremyatwsu0
0
votes
4
answers
1.2k
views
4
answers
Comment: C: CRISPRseek for Arabidopsis
... Not sure of these four warnings are useful to help diagnose the problem:   1: In dir.create(outputDir) :   'C:\Users\browse.lab\Documents' already exists 2: In dir.create(outputDir) :   'C:\Users\browse.lab\Documents' already exists 3: In .Seqinfo.mergexy(x, y) :   The 2 combined objects have no s ...
written 5.0 years ago by jeremyatwsu0
0
votes
4
answers
1.2k
views
4
answers
Comment: C: CRISPRseek for Arabidopsis
... Hi Julie,   I have test.fa in the same directory as inputseq.fa (the test file included with the package). The output indicates that gRNAs were discovered in my two test sequences in test.fa (AT1G67865 and AT1G67860). So it doesn't seem to be a problem of using my test.fa.  The problem is that g ...
written 5.0 years ago by jeremyatwsu0
0
votes
4
answers
1.2k
views
4
answers
Comment: C: CRISPRseek for Arabidopsis
... Still no change. Here is the fasta: >AT1G67865 ATGCTTGATAAGCTTATTATTGGGGTTGCCGGAGGGATTACCGGAGGGATTCTTGGAACGGTCGATGGGTTTGCCAAAGGGGTCGGGATATGGCCCAATAATTATCAGAGCACCGGTCGCTTCGAGAACAACAATATGACGAGTCCGGGAAACTACGGCAATGGTAATGGCGGTGCAGTGAAGGCATCCGAGAACTCCGGCGGCCGCCGCCAGAAAGACAGGGAGTAA >AT1G67860 ATGC ...
written 5.0 years ago by jeremyatwsu0
0
votes
4
answers
1.2k
views
4
answers
Comment: C: CRISPRseek for Arabidopsis
... Shucks.  That didn't work.  Still no entries in exon/intron columns nor in entrez_id column. I tried org.At.tairREFSEQ and org.At.tairENTREZID as well. Any other ideas?     ...
written 5.0 years ago by jeremyatwsu0
1
vote
4
answers
1.2k
views
4
answers
CRISPRseek for Arabidopsis
... Hi folks,   I am a new post-doc at Washington State University.  I don’t have a whole lot of bioinformatics experience, nevertheless I am trying to use CRISPRseek on the Arabidopsis genome.   Using a small test set (two genes), I can identify gRNA candidates, but there is a problem with the Offtarge ...
arabidopsis thaliana crisprseek written 5.0 years ago by jeremyatwsu0 • updated 5.0 years ago by Julie Zhu4.1k

Latest awards to jeremyatwsu

Popular Question 5.0 years ago, created a question with more than 1,000 views. For CRISPRseek for Arabidopsis

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 384 users visited in the last hour