User: prp291

gravatar for prp291
prp2910
Reputation:
0
Status:
New User
Location:
Last seen:
8 months ago
Joined:
1 year, 9 months ago
Email:
p*****@gmail.com

Posts by prp291

<prev • 7 results • page 1 of 1 • next >
0
votes
1
answers
186
views
1
answers
Comment: C: CRISPRseed gRNA.pattern is not producing expected result
... Thanks for your help. ...
written 8 months ago by prp2910
0
votes
1
answers
186
views
1
answers
Comment: C: CRISPRseed gRNA.pattern is not producing expected result
... Thanks for help. I just modified my script like this to get the minimum free en-ergy of the secondary structure of gRNA with gRNA backbone but I didn't get anything. Actually Summary file is also not generated in the end. Can you check whether it is also a kind of bug. results <- offTargetAnaly ...
written 8 months ago by prp2910
0
votes
1
answers
186
views
1
answers
Comment: C: CRISPRseed gRNA.pattern is not producing expected result
... Thanks. I am using this FASTA sequence to search the gRNA. >test ATGACGGAAAATTCAAAAGTATAACAATATAATTTTCAGGAAAATCATACTAATGATGTTCAAGGATTATTGAGTTTGTATGAAGCAGCACATATGAGAGTGCACGACGAGGAAATTCTAGAAGAAGCTCTTATCTTTACCACGACTCATCTCGCCATCGTAATTCGCGAATTTTGGAGTCCGTGATCCCGAATTTGAGCAACTCGCTTAAGGTACAAGTTACTGAAGCCT ...
written 8 months ago by prp2910
0
votes
1
answer
186
views
1
answer
CRISPRseed gRNA.pattern is not producing expected result
... Hi I am using the latest version of CRISPRseek (CRISPRseek_1.15.1). I used following script to search the gRNA without any off-target analysis results <- offTargetAnalysis( inputFilePath, findgRNAs=TRUE, gRNA.name.prefix="gRNA", PAM.size=3, gRNA.size=20, PAM="NGG", gRNA.pattern = "^G", #gRNA st ...
crisprseek written 8 months ago by prp2910 • updated 8 months ago by Julie Zhu3.8k
0
votes
1
answers
470
views
1
answers
Comment: C: No gene can be mapped error with clusterprofiler
... Thanks for your answer. I have already pointed out the problem and changed it with package varhandle. But your solution is more elegant. :) ...
written 10 months ago by prp2910
0
votes
1
answer
470
views
1
answer
No gene can be mapped error with clusterprofiler
... I am trying to use clusterprofiler to enrich the pathways in my datasets. But I am getting the error "No gene can be mapped". Any insight will be really helpful. Thanks > require(clusterProfiler) Loading required package: clusterProfiler Loading required package: DOSE > ra ...
clusterprofiler R written 10 months ago by prp2910 • updated 10 months ago by Guangchuang Yu800
0
votes
1
answer
2.2k
views
1
answer
Deseq2 for RNAseq experiments without replicates
... I am trying to find out the differentially expressed gene in a RNAseq experiment without replicate. The first R script is inspired by this post on seqanswer  and other script I always use for my other experiments with replicates. When I run first script I got 800 genes while second script is giving ...
rnaseq deseq2 written 22 months ago by prp2910 • updated 22 months ago by Michael Love15k

Latest awards to prp291

Popular Question 8 months ago, created a question with more than 1,000 views. For Deseq2 for RNAseq experiments without replicates

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 280 users visited in the last hour