I am staring at the miRNAs and mature miRNAs FASTA files I downloaded from one of the BioMart database The file format is as follows: >hsa-miR-26a MIMAT0000082 Homo sapiens miR-26a UUCAAGUAAUCCAGGAUAGGCU >hsa-miR-26b MIMAT0000082 Homo sapiens miR-26b UUCAAGUAAUUCAGGAUAGGU >hsa-miR-27a MIMAT0000084 Homo sapiens miR-27a UUCACAGUGGCUAAGUUCCGC >hsa-miR-28-5p MIMAT0000085 Homo sapiens miR-28-5p AAGGAGCUCACAGUCUAUUGAG So far, for each miRNA identifier, from the FASTA files above mentioned, I looked for it in the Excel file I downloaded from miRecords to read out the gene identifiers that link a single validated miRNA to its target genes, and get the correspondent 3utr sequences. My questions are: 1) I'd like to double-check that the miRNAs in the FASTA files above mentioned are really VALIDATED not just predicted. Is that true ? 2) Can I extract the target-genes 3UTR sequence providing BioMart functions with the identifiers present in the FASTA files above mentioned ("MIMAT0000082", "MIMAT0000082", "MIMAT0000085", and so on ...) What is the attribute name for such identifiers? Thank you in advance. Regards, Maura tutti i telefonini TIM! [[alternative HTML version deleted]]