makePdInfoPackage in preparation for RMA with oligo on Nimblegen Expression Arrays
3
0
Entering edit mode
@jack-schonbrun-3572
Last seen 11.1 years ago
Hello, I would like to use the oligo package to run the RMA algorithm on Nimblegen expression arrays. To that end, I am attempting to construct an annotation package using makePdInfoPackage(). I have followed the pattern in the "Building Annotation Packages with pdInfoBuilder for Use with the oligo Package" vignette: ---------------- > ndfFile.test <- "test.ndf" > xysFile.test <- "test.xys" > seed.test <- new("NgsExpressionPDInfoPkgSeed", ndfFile = ndfFile.test, xysFile = xysFile.test) > makePdInfoPackage(seed.test, destDir = "./Annotation") ====================================================================== ====================================================================== ============================= Building annotation package for Nimblegen Expression Array NDF: test.ndf XYS: test.xys ====================================================================== ====================================================================== ============================= Parsing file: test.ndf ... OK Parsing file: test.xys ... OK Merging NDF and XYS files ...OK Preparing contents for featureSet table ...OK Preparing contents for bgfeature table ...OK Preparing contents for pmfeature table ...OK Creating package in ./Annotation/pd.test Inserting 0 rows into table "featureSet"... Error in sqliteExecStatement(con, statement, bind.data) : RS-DBI driver: (incomplete data binding: expected 2 parameters, got 0) In addition: Warning messages: 1: In max(ndfdata[["Y"]]) : no non-missing arguments to max; returning -Inf 2: In max(ndfdata[["X"]]) : no non-missing arguments to max; returning -Inf 3: In sqliteExecStatement(con, statement, bind.data) : ignoring zero-row bind.data ------------------ Any help on why it would only be inserting 0 rows, or any of the other messages would be greatly appreciated. It does make some files in the destDir, but does not run to completion. Listing of this directory available if it would help. I am running on Windows XP SP 2. sessionInfo follows. > sessionInfo() R version 2.9.1 (2009-06-26) i386-pc-mingw32 locale: LC_COLLATE=English_United States.1252;LC_CTYPE=English_United States.1252;LC_MONETARY=English_United States.1252;LC_NUMERIC=C;LC_TIME=English_United States.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] pdInfoBuilder_1.8.1 affxparser_1.16.0 RSQLite_0.7-1 DBI_0.2-4 makePlatformDesign_1.8.0 oligo_1.8.1 [7] preprocessCore_1.6.0 oligoClasses_1.6.0 Biobase_2.4.1 affyio_1.12.0 loaded via a namespace (and not attached): [1] Biostrings_2.12.7 IRanges_1.2.3 splines_2.9.1 tools_2.9.1 =========================== Jack Schonbrun Ph.D. Software Developer Amyris Biotech
Annotation oligo Annotation oligo • 1.4k views
ADD COMMENT
0
Entering edit mode
@jack-schonbrun-3572
Last seen 11.1 years ago
Benilton, Thanks for your suggestions. By every means I have tested, the file is tab delimited. And the first row is headers, all other data. Here is how the first (header) row looks: PROBE_DESIGN_ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID PROBE_SEQUENCE MISMATCH MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS PROBE_ID POSITION DESIGN_ID X Y Any other details on how the ndf is expected to look? Thanks again, Jack -----Original Message----- From: Benilton Carvalho [mailto:bcarvalh@jhsph.edu] Sent: Tuesday, July 14, 2009 1:34 PM To: Jack Schonbrun Cc: bioconductor at stat.math.ethz.ch Subject: Re: [BioC] makePdInfoPackage in preparation for RMA with oligo on Nimblegen Expression Arrays Jack, it looks like your NDF isn't as expected. When it shows: "inserting 0 rows into table 'featureSet'", it makes me wonder how the SEQ_ID column in the NDF looks like. But, instead of looking at the columns' contents right now, please make sure the delimiters of the NDF are tabs. It doesn't appear that's the case. Note the warning "In max(ndfdata[["X"]]): no non-missing arguments to max; returning -Inf"... It suggests that ndfdata[["X"]] is NULL. Another thing: ensure the first line of the NDF is the header (column names) and the data start on the 2nd line. PLease let me know how it goes. b On Jul 14, 2009, at 3:57 PM, Jack Schonbrun wrote: > Hello, > > I would like to use the oligo package to run the RMA algorithm on > Nimblegen expression arrays. To that end, I am attempting to > construct an annotation package using makePdInfoPackage(). > > I have followed the pattern in the "Building Annotation Packages > with pdInfoBuilder > for Use with the oligo Package" vignette: > > ---------------- > >> ndfFile.test <- "test.ndf" >> xysFile.test <- "test.xys" >> seed.test <- new("NgsExpressionPDInfoPkgSeed", ndfFile = >> ndfFile.test, xysFile = xysFile.test) >> makePdInfoPackage(seed.test, destDir = "./Annotation") > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > ====================================================================== > Building annotation package for Nimblegen Expression Array > NDF: test.ndf > XYS: test.xys > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > = > ====================================================================== > Parsing file: test.ndf ... OK > Parsing file: test.xys ... OK > Merging NDF and XYS files ...OK > Preparing contents for featureSet table ...OK > Preparing contents for bgfeature table ...OK > Preparing contents for pmfeature table ...OK > Creating package in ./Annotation/pd.test > Inserting 0 rows into table "featureSet"... Error in > sqliteExecStatement(con, statement, bind.data) : > RS-DBI driver: (incomplete data binding: expected 2 parameters, got > 0) > In addition: Warning messages: > 1: In max(ndfdata[["Y"]]) : > no non-missing arguments to max; returning -Inf > 2: In max(ndfdata[["X"]]) : > no non-missing arguments to max; returning -Inf > 3: In sqliteExecStatement(con, statement, bind.data) : > ignoring zero-row bind.data > > ------------------ > > Any help on why it would only be inserting 0 rows, or any of the > other messages would be greatly appreciated. It does make some > files in the destDir, but does not run to completion. Listing of > this directory available if it would help. > > I am running on Windows XP SP 2. sessionInfo follows. > >> sessionInfo() > R version 2.9.1 (2009-06-26) > i386-pc-mingw32 > > locale: > LC_COLLATE=English_United States.1252;LC_CTYPE=English_United States. > 1252;LC_MONETARY=English_United States. > 1252;LC_NUMERIC=C;LC_TIME=English_United States.1252 > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] pdInfoBuilder_1.8.1 affxparser_1.16.0 > RSQLite_0.7-1 DBI_0.2-4 > makePlatformDesign_1.8.0 oligo_1.8.1 > [7] preprocessCore_1.6.0 oligoClasses_1.6.0 > Biobase_2.4.1 affyio_1.12.0 > > loaded via a namespace (and not attached): > [1] Biostrings_2.12.7 IRanges_1.2.3 splines_2.9.1 tools_2.9.1 > > > =========================== > Jack Schonbrun Ph.D. > Software Developer > Amyris Biotech > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
ADD COMMENT
0
Entering edit mode
@jack-schonbrun-3572
Last seen 11.1 years ago
Here's what I get: > ndf <- read.delim(ndfFile, stringsAsFactors=FALSE, nrow=100) > str(ndf) 'data.frame': 100 obs. of 17 variables: $ PROBE_DESIGN_ID : chr "6531_0301_0005" "6531_0311_0005" "6531_0331_0005" "6531_0333_0005" ... $ CONTAINER : chr "SACCHAROMYCES1" "SACCHAROMYCES1" "NGS_CONTROLS" "NGS_CONTROLS" ... $ DESIGN_NOTE : chr "rank_selected" "rank_selected" "upper right fiducial" "" ... $ SELECTION_CRITERIA: chr "rank:03;score:379;uniq:14;count:37;freq:01;rules:1;tm:82.4" "rank:05;score:046;uniq:14;count:1110;freq:30;rules:1;tm:78.3" "bright" "" ... $ SEQ_ID : chr "SCER070900001885" "SCER070900001596" "FIDUCIAL_UPPER_RIGHT" "CROSSHYBE" ... $ PROBE_SEQUENCE : chr "GTCAACCCTGCAAGATCTCTGGGTGCCGCCGTTGCTGCCAGATATTTCCCTCATTACCAC" "TCAGTTGGAACGCCTCTGAGCACTCCATCACCTGAGTCAGGTAATACATTTACTGATTCA" "TGAGTTGTTTGATAGGATTATTCATAGAGGTCATTACAGCGAGAGGAANNNNNNNNN" "CGATGCGACGCGAACTAAGCAGTTCGGCGCAGTCGACTAGTATAACAGNNNNNNNN" ... $ MISMATCH : int 0 0 0 0 0 0 0 0 0 0 ... $ MATCH_INDEX : int 72062965 72061238 2000207 70654015 70652179 65069272 65069273 65069274 65069275 65069276 ... $ FEATURE_ID : int 72062965 72061238 71722817 71722819 71722820 71722824 71722825 71722826 71722827 71722828 ... $ ROW_NUM : int 5 5 5 5 6 6 6 6 6 6 ... $ COL_NUM : int 301 311 331 333 1 5 6 7 8 9 ... $ PROBE_CLASS : chr "experimental" "experimental" "fiducial" "control:crosshybe" ... $ PROBE_ID : chr "SCER070900001885P00271" "SCER070900001596P00406" "CPK6" "XENOTRACK48P02" ... $ POSITION : int 271 406 0 2 0 0 5 0 6 0 ... $ DESIGN_ID : int 6531 6531 6531 6531 6531 6531 6531 6531 6531 6531 ... $ X : int 301 311 331 333 1 5 6 7 8 9 ... $ Y : int 5 5 5 5 6 6 6 6 6 6 ... > -----Original Message----- From: Benilton Carvalho [mailto:bcarvalh@jhsph.edu] Sent: Tuesday, July 14, 2009 2:56 PM To: Jack Schonbrun Cc: bioconductor at stat.math.ethz.ch Subject: Re: [BioC] makePdInfoPackage in preparation for RMA with oligo on Nimblegen Expression Arrays what do you get if you run the following (assuming ndfFile is a variable has the file name)? ndf <- read.delim(ndfFile, stringsAsFactors=FALSE, nrows=100) str(ndf) thanks, b On Jul 14, 2009, at 6:49 PM, Jack Schonbrun wrote: > Benilton, > > Thanks for your suggestions. > > By every means I have tested, the file is tab delimited. And the > first row is headers, all other data. > > Here is how the first (header) row looks: > PROBE_DESIGN_ID CONTAINER DESIGN_NOTE > SELECTION_CRITERIA SEQ_ID PROBE_SEQUENCE MISMATCH > MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS > PROBE_ID POSITION DESIGN_ID X Y > > Any other details on how the ndf is expected to look? > > Thanks again, > Jack > > > > > > -----Original Message----- > From: Benilton Carvalho [mailto:bcarvalh at jhsph.edu] > Sent: Tuesday, July 14, 2009 1:34 PM > To: Jack Schonbrun > Cc: bioconductor at stat.math.ethz.ch > Subject: Re: [BioC] makePdInfoPackage in preparation for RMA with > oligo on Nimblegen Expression Arrays > > Jack, > > it looks like your NDF isn't as expected. > > When it shows: "inserting 0 rows into table 'featureSet'", it makes me > wonder how the SEQ_ID column in the NDF looks like. > > But, instead of looking at the columns' contents right now, please > make sure the delimiters of the NDF are tabs. It doesn't appear that's > the case. Note the warning "In max(ndfdata[["X"]]): no non-missing > arguments to max; returning -Inf"... It suggests that ndfdata[["X"]] > is NULL. > > Another thing: ensure the first line of the NDF is the header (column > names) and the data start on the 2nd line. > > PLease let me know how it goes. > > b > > On Jul 14, 2009, at 3:57 PM, Jack Schonbrun wrote: > >> Hello, >> >> I would like to use the oligo package to run the RMA algorithm on >> Nimblegen expression arrays. To that end, I am attempting to >> construct an annotation package using makePdInfoPackage(). >> >> I have followed the pattern in the "Building Annotation Packages >> with pdInfoBuilder >> for Use with the oligo Package" vignette: >> >> ---------------- >> >>> ndfFile.test <- "test.ndf" >>> xysFile.test <- "test.xys" >>> seed.test <- new("NgsExpressionPDInfoPkgSeed", ndfFile = >>> ndfFile.test, xysFile = xysFile.test) >>> makePdInfoPackage(seed.test, destDir = "./Annotation") >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> ===================================================================== >> Building annotation package for Nimblegen Expression Array >> NDF: test.ndf >> XYS: test.xys >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> = >> ===================================================================== >> Parsing file: test.ndf ... OK >> Parsing file: test.xys ... OK >> Merging NDF and XYS files ...OK >> Preparing contents for featureSet table ...OK >> Preparing contents for bgfeature table ...OK >> Preparing contents for pmfeature table ...OK >> Creating package in ./Annotation/pd.test >> Inserting 0 rows into table "featureSet"... Error in >> sqliteExecStatement(con, statement, bind.data) : >> RS-DBI driver: (incomplete data binding: expected 2 parameters, got >> 0) >> In addition: Warning messages: >> 1: In max(ndfdata[["Y"]]) : >> no non-missing arguments to max; returning -Inf >> 2: In max(ndfdata[["X"]]) : >> no non-missing arguments to max; returning -Inf >> 3: In sqliteExecStatement(con, statement, bind.data) : >> ignoring zero-row bind.data >> >> ------------------ >> >> Any help on why it would only be inserting 0 rows, or any of the >> other messages would be greatly appreciated. It does make some >> files in the destDir, but does not run to completion. Listing of >> this directory available if it would help. >> >> I am running on Windows XP SP 2. sessionInfo follows. >> >>> sessionInfo() >> R version 2.9.1 (2009-06-26) >> i386-pc-mingw32 >> >> locale: >> LC_COLLATE=English_United States.1252;LC_CTYPE=English_United States. >> 1252;LC_MONETARY=English_United States. >> 1252;LC_NUMERIC=C;LC_TIME=English_United States.1252 >> >> attached base packages: >> [1] stats graphics grDevices utils datasets methods base >> >> other attached packages: >> [1] pdInfoBuilder_1.8.1 affxparser_1.16.0 >> RSQLite_0.7-1 DBI_0.2-4 >> makePlatformDesign_1.8.0 oligo_1.8.1 >> [7] preprocessCore_1.6.0 oligoClasses_1.6.0 >> Biobase_2.4.1 affyio_1.12.0 >> >> loaded via a namespace (and not attached): >> [1] Biostrings_2.12.7 IRanges_1.2.3 splines_2.9.1 tools_2.9.1 >> >> >> =========================== >> Jack Schonbrun Ph.D. >> Software Developer >> Amyris Biotech >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >
ADD COMMENT
0
Entering edit mode
@jack-schonbrun-3572
Last seen 11.1 years ago
> xys <- read.delim(xysFile, comment='#', nrow=3) > str(xys) 'data.frame': 3 obs. of 4 variables: $ X : int 209 228 43 $ Y : int 203 52 257 $ SIGNAL: num 203 146 159 $ COUNT : int 1 1 1 -----Original Message----- From: Benilton Carvalho [mailto:bcarvalh@jhsph.edu] Sent: Tuesday, July 14, 2009 3:03 PM To: Jack Schonbrun Cc: bioconductor at stat.math.ethz.ch Subject: Re: [BioC] makePdInfoPackage in preparation for RMA with oligo on Nimblegen Expression Arrays how about? xys <- read.delim(xysFile, comment="#", nrow=100) str(xys) b On Jul 14, 2009, at 6:58 PM, Jack Schonbrun wrote: > Here's what I get: > >> ndf <- read.delim(ndfFile, stringsAsFactors=FALSE, nrow=100) >> str(ndf) > 'data.frame': 100 obs. of 17 variables: > $ PROBE_DESIGN_ID : chr "6531_0301_0005" "6531_0311_0005" > "6531_0331_0005" "6531_0333_0005" ... > $ CONTAINER : chr "SACCHAROMYCES1" "SACCHAROMYCES1" > "NGS_CONTROLS" "NGS_CONTROLS" ... > $ DESIGN_NOTE : chr "rank_selected" "rank_selected" "upper > right fiducial" "" ... > $ SELECTION_CRITERIA: chr "rank:03;score:379;uniq:14;count:37;freq: > 01;rules:1;tm:82.4" "rank:05;score:046;uniq:14;count:1110;freq: > 30;rules:1;tm:78.3" "bright" "" ... > $ SEQ_ID : chr "SCER070900001885" "SCER070900001596" > "FIDUCIAL_UPPER_RIGHT" "CROSSHYBE" ... > $ PROBE_SEQUENCE : chr > "GTCAACCCTGCAAGATCTCTGGGTGCCGCCGTTGCTGCCAGATATTTCCCTCATTACCAC" > "TCAGTTGGAACGCCTCTGAGCACTCCATCACCTGAGTCAGGTAATACATTTACTGATTCA" > "TGAGTTGTTTGATAGGATTATTCATAGAGGTCATTACAGCGAGAGGAANNNNNNNNN" > "CGATGCGACGCGAACTAAGCAGTTCGGCGCAGTCGACTAGTATAACAGNNNNNNNN" ... > $ MISMATCH : int 0 0 0 0 0 0 0 0 0 0 ... > $ MATCH_INDEX : int 72062965 72061238 2000207 70654015 > 70652179 65069272 65069273 65069274 65069275 65069276 ... > $ FEATURE_ID : int 72062965 72061238 71722817 71722819 > 71722820 71722824 71722825 71722826 71722827 71722828 ... > $ ROW_NUM : int 5 5 5 5 6 6 6 6 6 6 ... > $ COL_NUM : int 301 311 331 333 1 5 6 7 8 9 ... > $ PROBE_CLASS : chr "experimental" "experimental" "fiducial" > "control:crosshybe" ... > $ PROBE_ID : chr "SCER070900001885P00271" > "SCER070900001596P00406" "CPK6" "XENOTRACK48P02" ... > $ POSITION : int 271 406 0 2 0 0 5 0 6 0 ... > $ DESIGN_ID : int 6531 6531 6531 6531 6531 6531 6531 6531 > 6531 6531 ... > $ X : int 301 311 331 333 1 5 6 7 8 9 ... > $ Y : int 5 5 5 5 6 6 6 6 6 6 ... >> > > -----Original Message----- > From: Benilton Carvalho [mailto:bcarvalh at jhsph.edu] > Sent: Tuesday, July 14, 2009 2:56 PM > To: Jack Schonbrun > Cc: bioconductor at stat.math.ethz.ch > Subject: Re: [BioC] makePdInfoPackage in preparation for RMA with > oligo on Nimblegen Expression Arrays > > what do you get if you run the following (assuming ndfFile is a > variable has the file name)? > > ndf <- read.delim(ndfFile, stringsAsFactors=FALSE, nrows=100) > str(ndf) > > thanks, > > b > > On Jul 14, 2009, at 6:49 PM, Jack Schonbrun wrote: > >> Benilton, >> >> Thanks for your suggestions. >> >> By every means I have tested, the file is tab delimited. And the >> first row is headers, all other data. >> >> Here is how the first (header) row looks: >> PROBE_DESIGN_ID CONTAINER DESIGN_NOTE >> SELECTION_CRITERIA SEQ_ID PROBE_SEQUENCE MISMATCH >> MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS >> PROBE_ID POSITION DESIGN_ID X Y >> >> Any other details on how the ndf is expected to look? >> >> Thanks again, >> Jack >> >> >> >> >> >> -----Original Message----- >> From: Benilton Carvalho [mailto:bcarvalh at jhsph.edu] >> Sent: Tuesday, July 14, 2009 1:34 PM >> To: Jack Schonbrun >> Cc: bioconductor at stat.math.ethz.ch >> Subject: Re: [BioC] makePdInfoPackage in preparation for RMA with >> oligo on Nimblegen Expression Arrays >> >> Jack, >> >> it looks like your NDF isn't as expected. >> >> When it shows: "inserting 0 rows into table 'featureSet'", it makes >> me >> wonder how the SEQ_ID column in the NDF looks like. >> >> But, instead of looking at the columns' contents right now, please >> make sure the delimiters of the NDF are tabs. It doesn't appear >> that's >> the case. Note the warning "In max(ndfdata[["X"]]): no non-missing >> arguments to max; returning -Inf"... It suggests that ndfdata[["X"]] >> is NULL. >> >> Another thing: ensure the first line of the NDF is the header (column >> names) and the data start on the 2nd line. >> >> PLease let me know how it goes. >> >> b >> >> On Jul 14, 2009, at 3:57 PM, Jack Schonbrun wrote: >> >>> Hello, >>> >>> I would like to use the oligo package to run the RMA algorithm on >>> Nimblegen expression arrays. To that end, I am attempting to >>> construct an annotation package using makePdInfoPackage(). >>> >>> I have followed the pattern in the "Building Annotation Packages >>> with pdInfoBuilder >>> for Use with the oligo Package" vignette: >>> >>> ---------------- >>> >>>> ndfFile.test <- "test.ndf" >>>> xysFile.test <- "test.xys" >>>> seed.test <- new("NgsExpressionPDInfoPkgSeed", ndfFile = >>>> ndfFile.test, xysFile = xysFile.test) >>>> makePdInfoPackage(seed.test, destDir = "./Annotation") >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> ==================================================================== >>> Building annotation package for Nimblegen Expression Array >>> NDF: test.ndf >>> XYS: test.xys >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> = >>> ==================================================================== >>> Parsing file: test.ndf ... OK >>> Parsing file: test.xys ... OK >>> Merging NDF and XYS files ...OK >>> Preparing contents for featureSet table ...OK >>> Preparing contents for bgfeature table ...OK >>> Preparing contents for pmfeature table ...OK >>> Creating package in ./Annotation/pd.test >>> Inserting 0 rows into table "featureSet"... Error in >>> sqliteExecStatement(con, statement, bind.data) : >>> RS-DBI driver: (incomplete data binding: expected 2 parameters, got >>> 0) >>> In addition: Warning messages: >>> 1: In max(ndfdata[["Y"]]) : >>> no non-missing arguments to max; returning -Inf >>> 2: In max(ndfdata[["X"]]) : >>> no non-missing arguments to max; returning -Inf >>> 3: In sqliteExecStatement(con, statement, bind.data) : >>> ignoring zero-row bind.data >>> >>> ------------------ >>> >>> Any help on why it would only be inserting 0 rows, or any of the >>> other messages would be greatly appreciated. It does make some >>> files in the destDir, but does not run to completion. Listing of >>> this directory available if it would help. >>> >>> I am running on Windows XP SP 2. sessionInfo follows. >>> >>>> sessionInfo() >>> R version 2.9.1 (2009-06-26) >>> i386-pc-mingw32 >>> >>> locale: >>> LC_COLLATE=English_United States.1252;LC_CTYPE=English_United >>> States. >>> 1252;LC_MONETARY=English_United States. >>> 1252;LC_NUMERIC=C;LC_TIME=English_United States.1252 >>> >>> attached base packages: >>> [1] stats graphics grDevices utils datasets methods base >>> >>> other attached packages: >>> [1] pdInfoBuilder_1.8.1 affxparser_1.16.0 >>> RSQLite_0.7-1 DBI_0.2-4 >>> makePlatformDesign_1.8.0 oligo_1.8.1 >>> [7] preprocessCore_1.6.0 oligoClasses_1.6.0 >>> Biobase_2.4.1 affyio_1.12.0 >>> >>> loaded via a namespace (and not attached): >>> [1] Biostrings_2.12.7 IRanges_1.2.3 splines_2.9.1 >>> tools_2.9.1 >>> >>> >>> =========================== >>> Jack Schonbrun Ph.D. >>> Software Developer >>> Amyris Biotech >>> >>> _______________________________________________ >>> Bioconductor mailing list >>> Bioconductor at stat.math.ethz.ch >>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >> >
ADD COMMENT

Login before adding your answer.

Traffic: 724 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6