Creating CDF

0

Entering edit mode

naresh kumar ▴ 40

@naresh-kumar-3577

Last seen 9.7 years ago

Dear mailing list, I got trouble in creating custom cdf in bio conductor.Could any one suggest me one tool or source which creates CDF. Thanks for your help in advance Naresh Looking for local information? Find it on Yahoo! Local http://in.local.yahoo.com/ [[alternative HTML version deleted]]

cdf cdf • 890 views

ADD COMMENT • link 14.8 years ago naresh kumar ▴ 40

0

Entering edit mode

James W. MacDonald 65k

@james-w-macdonald-5106

Last seen 3 days ago

United States

Hi Naresh, naresh kumar wrote: > Dear mailing list, > > I got trouble in creating custom cdf in bio conductor.Could any one suggest me one tool or source which creates CDF. Assuming that you want a cdf package for a custom CDF (where you actually have the CDF from Affy), you want the makecdfenv package. Best, Jim > > > Thanks for your help in advance > Naresh > > > > Looking for local information? Find it on Yahoo! Local http://in.local.yahoo.com/ > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician Douglas Lab University of Michigan Department of Human Genetics 5912 Buhl 1241 E. Catherine St. Ann Arbor MI 48109-5618 734-615-7826

ADD COMMENT • link 14.8 years ago James W. MacDonald 65k

0

Entering edit mode

Dear Dr.MacDonald, Thank you very much for your reply, I generated new probeset names by doing custom mapping of probes to Genome.The output file is in csv format i need that csv file converted to cdf.Is this possible through 'makecdfenv' package ? otherwise if possible please provide me any kind of information to do it. I'm displaying few rows of my file to be clear. Probe Set Name Probe X Probe Y Probe Interrogation Position Probe Sequence Target Strandedness Alignment Chromosome Transcript exon NewProbe Indication 1007_s_at:718:317; 718 317 3330 CACCCAGCTGGTCCTGTGGATGGGA Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s 1007_s_at:1105:483; 1105 483 3443 GCCCCACTGGACAACACTGATTCCT Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s 1007_s_at:584:901; 584 901 3512 TGGACCCCACTGGCTGAGAATCTGG Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s 1007_s_at:192:205; 192 205 3563 AAATGTTTCCTTGTGCCTGCTCCTG Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s 1007_s_at:844:979; 844 979 3570 TCCTTGTGCCTGCTCCTGTACTTGT Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s 1007_s_at:537:971; 537 971 3576 TGCCTGCTCCTGTACTTGTCCTCAG Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s Thanks and Regards Naresh --- On Fri, 17/7/09, James W. MacDonald <jmacdon@med.umich.edu> wrote: From: James W. MacDonald <jmacdon@med.umich.edu> Subject: Re: [BioC] Creating CDF To: "naresh kumar" <naresh4836@yahoo.co.in> Cc: bioconductor@stat.math.ethz.ch Date: Friday, 17 July, 2009, 2:26 AM Hi Naresh, naresh kumar wrote: > Dear mailing list, > > I got trouble in creating custom cdf in bio conductor.Could any one suggest me one tool or source which creates CDF. Assuming that you want a cdf package for a custom CDF (where you actually have the CDF from Affy), you want the makecdfenv package. Best, Jim > > > Thanks for your help in advance > Naresh > > > > Looking for local information? Find it on Yahoo! Local http://in.local.yahoo.com/ > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician Douglas Lab University of Michigan Department of Human Genetics 5912 Buhl 1241 E. Catherine St. Ann Arbor MI 48109-5618 734-615-7826 See the Web's breaking stories, chosen by people like you. Check out Yahoo! Buzz. http://in.buzz.yahoo.com/ [[alternative HTML version deleted]]

ADD REPLY • link 14.8 years ago naresh kumar ▴ 40

0

Entering edit mode

naresh kumar wrote: > Dear Dr.MacDonald, > > Thank you very much for your reply, > > I generated new probeset names by doing custom mapping of probes to > Genome.The output file is in csv format i need that csv file converted > to cdf.Is this possible through > 'makecdfenv' package ? otherwise if possible please provide me any kind > of information to do it.. No. You need to use the affxparser package: http://article.gmane.org/gmane.science.biology.informatics.conductor/2 1824/match=create+cdf Best, Jim > > I'm displaying few rows of my file to be clear. > Probe Set Name Probe X Probe Y Probe Interrogation Position Probe > Sequence Target Strandedness Alignment Chromosome Transcript exon > NewProbe Indication > 1007_s_at:718:317; 718 317 3330 CACCCAGCTGGTCCTGTGGATGGGA > Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s > 1007_s_at:1105:483; 1105 483 3443 GCCCCACTGGACAACACTGATTCCT > Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s > 1007_s_at:584:901; 584 901 3512 TGGACCCCACTGGCTGAGAATCTGG > Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s > 1007_s_at:192:205; 192 205 3563 AAATGTTTCCTTGTGCCTGCTCCTG > Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s > 1007_s_at:844:979; 844 979 3570 TCCTTGTGCCTGCTCCTGTACTTGT > Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s > 1007_s_at:537:971; 537 971 3576 TGCCTGCTCCTGTACTTGTCCTCAG > Antisense 1 6 uc003nrv.1 exon16 chr6probe447 s > > > > Thanks and Regards > Naresh > > --- On *Fri, 17/7/09, James W. MacDonald /<jmacdon at="" med.umich.edu="">/* wrote: > > > From: James W. MacDonald <jmacdon at="" med.umich.edu=""> > Subject: Re: [BioC] Creating CDF > To: "naresh kumar" <naresh4836 at="" yahoo.co..in=""> > Cc: bioconductor at stat.math.ethz.ch > Date: Friday, 17 July, 2009, 2:26 AM > > Hi Naresh, > > naresh kumar wrote: > > Dear mailing list, > > > > I got trouble in creating custom cdf in bio conductor.Could any > one suggest me one tool or source which creates CDF. > > Assuming that you want a cdf package for a custom CDF (where you > actually have the CDF from Affy), you want the makecdfenv package. > > Best, > > Jim > > > > > > > > Thanks for your help in advance > > Naresh > > > > > > > > Looking for local information? Find it on Yahoo! Local > http://in.local.yahoo.com/ > > [[alternative HTML version deleted]] > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor at stat.math.ethz.ch > </mc> > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > -- James W. MacDonald, M.S. > Biostatistician > Douglas Lab > University of Michigan > Department of Human Genetics > 5912 Buhl > 1241 E. Catherine St. > Ann Arbor MI 48109-5618 > 734-615-7826 > > > -------------------------------------------------------------------- ---- > See the Web's breaking stories, chosen by people like you. Check out > Yahoo! Buzz > <http: in.rd.yahoo.com="" tagline_buzz_1="" *http:="" in.buzz.yahoo.com=""/>. -- James W. MacDonald, M.S. Biostatistician Douglas Lab University of Michigan Department of Human Genetics 5912 Buhl 1241 E. Catherine St. Ann Arbor MI 48109-5618 734-615-7826

ADD REPLY • link 14.8 years ago James W. MacDonald 65k

0

Entering edit mode

naresh kumar ▴ 40

@naresh-kumar-3577

Last seen 9.7 years ago

Dear mailing list, I got trouble in creating custom cdf in bio conductor. Source : http://groups.google.com/group/aroma-affymetrix/web/creating-cdf- files-from-scratch According to below paragraph I'm using Flat2cdf.R function but in that the input file contains 1st column probeID as numeric instead of string. So the program is giving erros.If you have any idea about this program please give me suggestion. The main file for making the cdf is flat2cdf.R, a function in R that takes a 'flat' file and converts it to a binary cdf file. The flat file is a tab deliminated file with each row corresponding to a probe to be included in the cdf. Right now the format of a 'flat' file is a bit rigid. It must be: * tab-deliminated * have a header row * A column 'X' and 'Y' with the x,y coordinates of a file (there is an argument that allows to pass other names, but not really tested yet) * A column identifying a probe to a group and a column identifying a probe to a unit (for exon arrays, group=exon, unit=gene; for gene arrays, unit=group=gene); these identifications will the group and unit names respectively. * Other columns are allowed and will be ignored. Example: Probe_ID X Y Probe_Sequence Group_ID Unit_ID 15 14 0 TCTCCAGTGAAGTGCACATTGCTCA 3029044 ENSG00000106144 17 16 0 TGATCGCCTGTCTGCAGATAGGGCA 2400195 ENSG00000090432 29 28 0 TGTAGCTACATGAGGTCTCAGCAGT 2690968 ENSG00000121577 Thanks and Regards Naresh P Thanks for your help in advance Naresh Looking for local information? Find it on Yahoo! Local Yahoo! recommends that you upgrade to the new and safer Internet Explorer 8. http://downloads.yahoo.com/in/internetexplorer/ [[alternative HTML version deleted]]

ADD COMMENT • link 14.8 years ago naresh kumar ▴ 40

Login before adding your answer.