Dear list, having a look at the vegfc gene (located on the reverse strand) on the website of biomart and querying the 5utr and the flanking sequence yields the following: http://www.ensembl.org/Homo_sapiens/Transcript/Export?db=core;g=ENSG00 000150630;output=fasta;r=4:177604691-177713895;strand=feature;t=ENST00 000280193;param=utr5;genomic=5_flanking;_format=HTML Doing the same in R, yields essentially the same with the only difference that in the case of the flanking sequence the reverse complement is given: library(biomaRt) library(Biostrings) ensembl = useMart("ensembl", dataset = "hsapiens_gene_ensembl") vegfc_fs = getSequence(id = c("ENST00000280193"), type = "ensembl_transcript_id", seqType = "transcript_flank", upstream = 3000, mart = ensembl) vegfc_utr = getSequence(id = c("ENST00000280193"), type = "ensembl_transcript_id", seqType = "5utr", mart = ensembl) As the gene is located on the reverse strand, one would probably be interested in the reverse complement of the sequence returned by ensemble/biomart. Although it's nice that the flanking sequence is already reverse complemented in R, it should be somehow documented. And the question arises, why does biomaRt only return the reverse complement of the flanking sequence but not of the utr? I would appreciate any hints! Thanks a lot in advance, Best, Tefina > sessionInfo() R version 2.9.1 (2009-06-26) i386-pc-mingw32 locale: LC_COLLATE=English_United Kingdom.1252;LC_CTYPE=English_United Kingdom.1252;LC_MONETARY=English_United Kingdom.1252;LC_NUMERIC=C;LC_TIME=English_United Kingdom.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] Biostrings_2.12.8 IRanges_1.2.3 biomaRt_2.0.0 loaded via a namespace (and not attached): [1] Biobase_2.4.1 RCurl_0.98-1 XML_2.5-3 [[alternative HTML version deleted]]

Hi Tefina, Tefina Paloma wrote: > Dear list, > > having a look at the vegfc gene (located on the reverse strand) on the > website of biomart and querying the 5utr and the flanking sequence yields > the following: > > http://www.ensembl.org/Homo_sapiens/Transcript/Export?db=core;g=ENSG 00000150630;output=fasta;r=4:177604691-177713895;strand=feature;t=ENST 00000280193;param=utr5;genomic=5_flanking;_format=HTML > > Doing the same in R, yields essentially the same with the only difference > that in the case of the flanking sequence the reverse complement is given: > > library(biomaRt) > library(Biostrings) > > ensembl = useMart("ensembl", dataset = "hsapiens_gene_ensembl") > > vegfc_fs = getSequence(id = c("ENST00000280193"), type = > "ensembl_transcript_id", > seqType = "transcript_flank", upstream = 3000, > mart = ensembl) > > vegfc_utr = getSequence(id = c("ENST00000280193"), type = > "ensembl_transcript_id", > seqType = "5utr", mart = ensembl) > > > As the gene is located on the reverse strand, one would probably be > interested in the reverse complement of the sequence returned by > ensemble/biomart. > > Although it's nice that the flanking sequence is already reverse > complemented in R, it should be somehow documented. The flanking sequence isn't reverse complemented in R, it is reported exactly as it is received from the Biomart server. I am a bit confused here as well; AFAICT, the sequence for the 5' flank and UTR are identical from all sources (Ensembl, Biomart and biomaRt). 5' flank: Ensembl ccgccgccagcgcccccgccgcagcgcccgcggcccggctcctctcactt Biomart CCGCCGCCAGCGCCCCCGCCGCAGCGCCCGCGGCCCGGCTCCTCTCACTT biomaRt CCGCCGCCAGCGCCCCCGCCGCAGCGCCCGCGGCCCGGCTCCTCTCACTT 5'UTR Ensembl CACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGGTCCTTCCACC Biomart CACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGGTCCTTCCACC biomaRt CACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGGTCCTTCCACC Best, Jim > > And the question arises, why does biomaRt only return the reverse complement > of the flanking sequence but not of the utr? > > I would appreciate any hints! > Thanks a lot in advance, > Best, > Tefina > >> sessionInfo() > R version 2.9.1 (2009-06-26) > i386-pc-mingw32 > > locale: > LC_COLLATE=English_United Kingdom.1252;LC_CTYPE=English_United > Kingdom.1252;LC_MONETARY=English_United > Kingdom.1252;LC_NUMERIC=C;LC_TIME=English_United Kingdom.1252 > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] Biostrings_2.12.8 IRanges_1.2.3 biomaRt_2.0.0 > > loaded via a namespace (and not attached): > [1] Biobase_2.4.1 RCurl_0.98-1 XML_2.5-3 > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician Douglas Lab University of Michigan Department of Human Genetics 5912 Buhl 1241 E. Catherine St. Ann Arbor MI 48109-5618 734-615-7826

James W. MacDonald <jmacdon at="" ...=""> writes: Hi, if I just export the sequence by using the "export data" button on the left hand side of the biomart page. I do not do this ususally, but I just wanted to compare the different possibilities of exporting the sequence to make sure that I always get the same sequence. Best, Tefina

Thanks a lot for your help, whit blat everything is really clear to me now. But indeed, a rather bad bug in the export wizard. Best, Tefina

Hi, So, regardless if the gene is on the forward or on the reverse strand, the "start coordinates" for any kind of sequence are always lower than the "end coordinates". e.g. for Gene ENSG00000150630, Transcript ENST00000280193 and Exon ENSE00001153189 Start: 177,713,319 End: 177,713,895 So, if the gene is on the reverse strand, the sequence actually goes from the "end coordinates" to the "start coordinates". Am I right? Thanks a lot for all your help, Tefina