Hello, I am doing analysis on the two color data set with common reference sample (Agilent). I am able to generate list of differentially expressed genes but having trouble to remove control probes from the list. I am having difficulty in understanding "asMatrixWeights()" command. I have column in my data titled "ControlType" with 1 or -1 corresponding to control probes and I want to eliminate them from my analysis. "ControlType =0" are the actual probes. Is there anyway to write "isGene" command so that only ControlType=0 can be considered for fitting subsequent models. I also have a text file with the list of various control probes. Is there any way I can pull the info from there and assign them as not relevant for analysis. > library(limma) > getwd() [1] "/Users/Neel/agilent/limma" > setwd("/Users/Neel/agilent/limma") > getwd() [1] "/Users/Neel/agilent/limma" > targets = readTargets() > targets = readTargets("Targets.txt", row.names = "Name") > RG = read.maimages(targets, source ="agilent") Read conta.txt Read contb.txt Read contc.txt Read contd.txt Read pcba.txt Read pcbb.txt Read pcbc.txt Read pcbd.txt > spottypes = readSpotTypes() > RG$genes$Status = controlStatus(spottypes, RG) Matching patterns for: ProbeName GeneName Found 44407 gene Found 14 BLANK Found 604 Blank Found 320 positive Found 153 negative Found 130 flag1 Found 120 flag2 Setting attributes: values Color > myfun = function(x) as.numeric(x$ControlType > -50.5) > RG = read.maimages(targets, source="agilent", wt.fun=myfun) Read conta.txt Read contb.txt Read contc.txt Read contd.txt Read pcba.txt Read pcbb.txt Read pcbc.txt Read pcbd.txt > MA = normalizeWithinArrays(RG, method="loess", weights=NULL) > RG.b = backgroundCorrect(RG, method="normexp", offset=50) Green channel Corrected array 1 Corrected array 2 Corrected array 3 Corrected array 4 Corrected array 5 Corrected array 6 Corrected array 7 Corrected array 8 Red channel Corrected array 1 Corrected array 2 Corrected array 3 Corrected array 4 Corrected array 5 Corrected array 6 Corrected array 7 Corrected array 8 > MA.p = normalizeWithinArrays(RG.b, method="loess") > MA.pAq = normalizeBetweenArrays(MA.p, method = "Aquantile") > design = cbind(CONT=c(0,0,0,0,1,1,1,1), PCB=c(1,1,1,1,0,0,0,0)) > fit = lmFit(MA, design) Warning message: Partial NA coefficients for 1269 probe(s) > cont.matrix = makeContrasts(PCBvsCONT=PCB-CONT, levels=design) > fit2 = contrasts.fit(fit, cont.matrix) > fit2 = eBayes(fit2) > topTable(fit2, number = 10, adjust="BH") Row Col Start Sequence ProbeUID ControlType ProbeName GeneName 25521 306 66 0 GCTAACATGGTCTCCAATGGCAGTTTGTTGTTGCATAGCATATTTATGATGTTGGCAAAA 17654 0 A_15_P100578 cyp1a 26068 313 23 0 GCTAACATGGTCTCCAATGGCAGTTTGTTGTTGCATAGCATATTTATGATGTTGGCAAAA 17654 0 A_15_P100578 cyp1a 22261 267 65 0 GTCTGTGTTTTTGGGCTAGAGATGTACAGAGATGATTCTTATGCTTAAAAGGAGGATTTT 16235 0 A_15_P116040 si:dkey-13a21.15 25361 304 72 0 ACCAAAAGAGTGTGAAGGTAAAAGATTGAAGACTGTGTTGGGTTTTTATTGGATTCGTGA 17593 0 A_15_P119653 drd3 37362 448 41 0 CTGAACTAAGAAGTGGCTACCAGCACTGTCAAATAAGCATATACAGGAAAAACTAAATAA 5780 0 A_15_P102530 ugt1aa 32555 391 7 0 GCTTCATCTCAGATTGCAGCAGTGTTATGTGTTCTATGCATTGAAATAAAATAATGCACA 20037 0 A_15_P118356 gabpb2 28154 338 38 0 ACCAGTAACCACAGGATTAAGTTCATTACCATCACCGTATCTTGCTCTCCTGAAGTCCAT 18652 0 A_15_P105185 elp4 3413 41 65 0 GGTTTATTGTTGATTATGTAGATCCCCATTAGCCACTATCAACATAGTGGTTACTCGTCC 3040 0 A_15_P107325 hsf1 34336 412 26 0 ATAAATCCTGTGAATCTCAATACAGTGTCTGAAAACATGTGTCCATTTTTACTCTGTTGC 20460 0 A_15_P102917 wdr12 34569 415 6 0 CCCCCCAAAATGCTGTAAATTACTATATTTTCATTTAAAATTTGGAAAGAATTGGTATCT 12610 0 A_15_P108015 mapk14b SystematicName 25521 NM_131879 26068 NM_131879 22261 NM_001083843 25361 BC076352 37362 BC100055 32555 NM_212712 28154 NM_001017638 3413 NM_131600 34336 NM_199557 34569 NM_178223 Description logFC 25521 "ref|Danio rerio cytochrome P450, family 1, subfamily A (cyp1a), mRNA [NM_131879]" -5.231141 26068 "ref|Danio rerio cytochrome P450, family 1, subfamily A (cyp1a), mRNA [NM_131879]" -5.094103 22261 "ref|Danio rerio si :dkey-13a21.15 (si:dkey-13a21.15), mRNA [NM_001083843]" 2.994005 25361 "gb|Danio rerio dopamine receptor D3, mRNA (cDNA clone MGC:92896 IMAGE:7118973), complete cds. [BC076352]" -2.144771 37362 "gb|Danio rerio UDP glucuronosyltransferase 1 family a, a, mRNA (cDNA clone IMAGE:7284571), partial cds. [BC100055]" -2.557859 32555 "ref|Danio rerio GA repeat binding protein, beta 2 (gabpb2), mRNA [NM_212712]" 2.211286 28154 "ref|Danio rerio elongation protein 4 homolog (S. cerevisiae) (elp4), mRNA [NM_001017638]" 3.755883 3413 "ref|Danio rerio heat shock transcription factor 1 (hsf1), mRNA [NM_131600]" -3.005454 34336 "ref|Danio rerio WD repeat domain 12 (wdr12), mRNA [NM_199557]" 1.511836 34569 "ref|Danio rerio mitogen- activated protein kinase 14b (mapk14b), mRNA [NM_178223]" -2.155142 AveExpr t P.Value adj.P.Val B 25521 12.597193 -30.025678 3.565209e-09 0.0001534394 2.82418014 26068 12.481079 -26.545758 9.021446e-09 0.0001941325 2.76354911 22261 5.474685 10.205127 2.777888e-05 0.3985158471 0.52258102 25361 5.733082 -6.881963 1.611209e-04 0.6678374033 0.30028005 37362 6.635666 -7.874792 1.369250e-04 0.6678374033 -0.01742959 32555 5.982746 6.187841 3.238173e-04 0.7066158126 -0.08376019 28154 5.480283 7.643937 1.638003e-04 0.6678374033 -0.08963515 3413 4.849755 -7.322943 2.117418e-04 0.6951770618 -0.19736474 34336 7.124021 5.990976 3.987536e-04 0.7066158126 -0.20474318 34569 4.560762 -7.065892 2.618034e-04 0.7066158126 -0.29029278 Once I got this, now I am trying to remove control spots... Any ideas will be appreciated. Thank you, Neel Neel Aluru Postdoctoral Scholar Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543 USA 508-289-3607