dear ALL, harry and steve? i am so sorry to disturb you again.but this time,i read the mannu and some source coding carefully. but still confused with the process how trimLRPatterns works? i trace back to the function Biostrings:::.computeTrimEnd showMethods(which.isMatchingEndingAt, includeDefs=TRUE) Biostrings:::.matchPatternAt if (is(subject, "XString")) .Call2("XString_match_pattern_at", pattern, subject, at, at.type, max.mismatch, min.mismatch, with.indels, fixed, ans.type, auto.reduce.pattern, PACKAGE = "Biostrings") else .Call2("XStringSet_vmatch_pattern_at", pattern, subject, at, at.type, max.mismatch, min.mismatch, with.indels, fixed, ans.type, auto.reduce.pattern, PACKAGE = "Biostrings") i think it will call the low level coding. for example: trimLRPatterns(Rpattern = Rpattern, subject = subject, max.Rmismatch=0.1, with.Lindels=TRUE) subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" then the function will change max.Rmismatch to max.Rmismatch= as.integer(max.Rmismatch*1:nchar(Rpattern)) [1] 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 as i know the process is,it try to get the distance between p and s p = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" allowing 3 mismatch s = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" p = "AATAGTACTGTAGGCACCATCAATAGATCGGAA" allowing 3 mismatch s = "GAATAGTACTGTAGGCACCATCAATAGATCGGA" ... p = "A" allowing 0 mismatch s = "G" but what does the parameter at mean? -- shan gao Room 231(Dr.Fei lab) Boyce Thompson Institute Cornell University Tower Road, Ithaca, NY 14853-1801 Office phone: 1-607-254-1267(day) Official email:sg839 at cornell.edu Facebook:http://www.facebook.com/profile.php?id=100001986532253

On Nov 6, 2012, at 3:02 PM, wang peter wrote: > dear ALL, harry and steve? > i am so sorry to disturb you again.but this time,i read the mannu > and some source coding carefully. but still confused with the process > how trimLRPatterns works? > i trace back to the function > > Biostrings:::.computeTrimEnd The relevant statement is ii <- which.isMatchingEndingAt(pattern = Rpattern, subject = subject, ending.at = subject_width, max.mismatch = max.Rmismatch, with.indels = with.Rindels, fixed = Rfixed, auto.reduce.pattern = TRUE) 'subject_width' is constant at this time, because of this earlier test: if (!isConstant(width(subject))) { tmp <- .computeTrimStart(reverse(Rpattern), reverse(subject), max.Rmismatch, with.Rindels, Rfixed) return(width(subject) - tmp + 1L) } auto.reduce.pattern=TRUE tells the *EndingAt function to test a vector of patterns against each subject element subject to the 'max.mismatch' vector of edit distance limits. These patterns are constructed behind the scenes (in C) from your single 'pattern=Rpattern'. For example, if your Rpattern was "TCGGAA", the test patterns would be, in order, "TCGGAA" "TCGGA" "TCGG" "TCG" "TC" "T" They are tested using 'ending.at=subject_width', as I've hinted by the way I've written them. The "which" in the function name is associated with its underlying code (in this case, C code) stopping at the first hit, subject to your edit limits. For example, if a subject element happens to end with "TCGGA" within your limits, the test loop for that subject element stops. > showMethods(which.isMatchingEndingAt, includeDefs=TRUE) > Biostrings:::.matchPatternAt > > if (is(subject, "XString")) > .Call2("XString_match_pattern_at", pattern, subject, > at, at.type, max.mismatch, min.mismatch, with.indels, > fixed, ans.type, auto.reduce.pattern, PACKAGE = "Biostrings") > else .Call2("XStringSet_vmatch_pattern_at", pattern, subject, > at, at.type, max.mismatch, min.mismatch, with.indels, > fixed, ans.type, auto.reduce.pattern, PACKAGE = "Biostrings") > > i think it will call the low level coding. Yes, these are calls to C. 'at.type' is set to 1L by all the *EndingAt functions (and to 0L by all the *StartingAt functions). The statement above in .computeTrimEnd supplies 'ending.at', namely the subject width, which is sent as the 'at' argument of .matchPatternAt and forwarded to C. > for example: > trimLRPatterns(Rpattern = Rpattern, subject = subject, > max.Rmismatch=0.1, with.Lindels=TRUE) > > subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA" > Rpattern = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" > > then the function will change max.Rmismatch to > max.Rmismatch= as.integer(max.Rmismatch*1:nchar(Rpattern)) > [1] 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 > > as i know the process is,it try to get the distance between p and s > > p = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" allowing 3 mismatch > s = "GAATAGTACTGTAGGCACCATCAATAGATCGGAA" > > p = "AATAGTACTGTAGGCACCATCAATAGATCGGAA" allowing 3 mismatch > s = "GAATAGTACTGTAGGCACCATCAATAGATCGGA" > ... > p = "A" allowing 0 mismatch > s = "G" > > but what does the parameter at mean? See 'at' and 'ending.at' above. Does this help? > -- > shan gao > Room 231(Dr.Fei lab) > Boyce Thompson Institute > Cornell University > Tower Road, Ithaca, NY 14853-1801 > Office phone: 1-607-254-1267(day) > Official email:sg839 at cornell.edu > Facebook:http://www.facebook.com/profile.php?id=100001986532253 > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor