cdf redesign
1
0
Entering edit mode
@claudio-isella-6072
Last seen 11.2 years ago
Dear BioC, I am trying to handle low level data information from affymetrix gene chips. what I want to do is to redesign cdf files according to my peculiar experiment. the point is that I download from affymetrix website the information regarding all the probes; after data analysis I would like to convert the information that are provided with the fasta files to the index available in library files such as the one "hgu133acdf" now if explore the fasta files from affymetrix I retrieve this information: >probe:HG-U133A:1007_s_at:467:181; Interrogation_Position=3330; Antisense; CACCCAGCTGGTCCTGTGGATGGGA >probe:HG-U133A:1007_s_at:531:299; Interrogation_Position=3443; Antisense; GCCCCACTGGACAACACTGATTCCT >probe:HG-U133A:1007_s_at:86:557; Interrogation_Position=3512; Antisense; TGGACCCCACTGGCTGAGAATCTGG >probe:HG-U133A:1007_s_at:365:115; Interrogation_Position=3563; Antisense; AAATGTTTCCTTGTGCCTGCTCCTG >probe:HG-U133A:1007_s_at:207:605; Interrogation_Position=3570; Antisense; TCCTTGTGCCTGCTCCTGTACTTGT >probe:HG-U133A:1007_s_at:593:599; Interrogation_Position=3576; Antisense; TGCCTGCTCCTGTACTTGTCCTCAG >probe:HG-U133A:1007_s_at:425:607; Interrogation_Position=3583; Antisense; TCCTGTACTTGTCCTCAGCTTGGGC however if I ask to the package "hgu133acdf" the index corresponding to the probes 1007_s_at I obtain > exSet pm mm [1,] 129340 130052 [2,] 213420 214132 [3,] 396671 397383 [4,] 82246 82958 [5,] 430968 431680 [6,] 427082 427794 [7,] 432610 433322 [8,] 72465 73177 [9,] 432865 433577 [10,] 99501 100213 [11,] 504952 505664 [12,] 443862 444574 [13,] 341432 342144 [14,] 198778 199490 [15,] 463575 464287 [16,] 10989 11701 even if I apply xy2indeces I could not find any correspondence. pleas could you help me and tell me where I am wrong? -- Claudio Isella [[alternative HTML version deleted]]
cdf convert cdf convert • 803 views
ADD COMMENT
0
Entering edit mode
@james-w-macdonald-5106
Last seen 1 hour ago
United States
Hi Claudio, On 8/1/2013 10:25 AM, Claudio Isella wrote: > Dear BioC, > > I am trying to handle low level data information from affymetrix gene chips. > what I want to do is to redesign cdf files according to my peculiar experiment. > > the point is that I download from affymetrix website the information regarding all the probes; > after data analysis I would like to convert the information that are provided with the fasta files to the index available in library files such as the one "hgu133acdf" > > now if explore the fasta files from affymetrix I retrieve this information: >> probe:HG-U133A:1007_s_at:467:181; Interrogation_Position=3330; Antisense; > CACCCAGCTGGTCCTGTGGATGGGA >> probe:HG-U133A:1007_s_at:531:299; Interrogation_Position=3443; Antisense; > GCCCCACTGGACAACACTGATTCCT >> probe:HG-U133A:1007_s_at:86:557; Interrogation_Position=3512; Antisense; > TGGACCCCACTGGCTGAGAATCTGG >> probe:HG-U133A:1007_s_at:365:115; Interrogation_Position=3563; Antisense; > AAATGTTTCCTTGTGCCTGCTCCTG >> probe:HG-U133A:1007_s_at:207:605; Interrogation_Position=3570; Antisense; > TCCTTGTGCCTGCTCCTGTACTTGT >> probe:HG-U133A:1007_s_at:593:599; Interrogation_Position=3576; Antisense; > TGCCTGCTCCTGTACTTGTCCTCAG >> probe:HG-U133A:1007_s_at:425:607; Interrogation_Position=3583; Antisense; > TCCTGTACTTGTCCTCAGCTTGGGC > > however if I ask to the package "hgu133acdf" the index corresponding to the probes 1007_s_at > > I obtain > >> exSet > pm mm > [1,] 129340 130052 > [2,] 213420 214132 > [3,] 396671 397383 > [4,] 82246 82958 > [5,] 430968 431680 > [6,] 427082 427794 > [7,] 432610 433322 > [8,] 72465 73177 > [9,] 432865 433577 > [10,] 99501 100213 > [11,] 504952 505664 > [12,] 443862 444574 > [13,] 341432 342144 > [14,] 198778 199490 > [15,] 463575 464287 > [16,] 10989 11701 > > even if I apply xy2indeces I could not find any correspondence. > > pleas could you help me and tell me where I am wrong? You don't show what you have done, so nobody can tell you where you went wrong. I do get the expected data using indices2xy, however: > indices2xy(get("1007_s_at", hgu133acdf)[,1], cdf="hgu133acdf") x y [1,] 467 181 [2,] 531 299 [3,] 86 557 [4,] 365 115 [5,] 207 605 [6,] 593 599 [7,] 425 607 [8,] 552 101 [9,] 680 607 [10,] 532 139 [11,] 143 709 [12,] 285 623 [13,] 383 479 [14,] 129 279 [15,] 62 651 [16,] 308 15 Best, Jim Best, Jim > > -- > Claudio Isella > > > > > > > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician University of Washington Environmental and Occupational Health Sciences 4225 Roosevelt Way NE, # 100 Seattle WA 98105-6099
ADD COMMENT

Login before adding your answer.

Traffic: 862 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6