The editor has been updated to markdown! Please see more info at: Tutorial: Updated Support Site Editor

User: hwu12

gravatar for hwu12
New User
Last seen:
7 months ago
2 years ago

Posts by hwu12

<prev • 20 results • page 1 of 2 • next >
Comment: C: featureCounts for multiple features
... Thanks so much, Wei and Gordon!!! ...
written 7 months ago by hwu1210
featureCounts for multiple features
... Hi, I am using the linux version of featureCounts, and I would like to count the number of reads in CDS, 5'UTR and 3'UTR. I was wondering if I should just count three times like: featureCounts -t CDS -g gene_id -a $GTF -o counts.txt $BAM featureCounts -t five_prime_UTR -g gene_id -a $GTF -o counts.t ...
featurecounts written 7 months ago by hwu1210 • updated 7 months ago by Wei Shi3.0k
Answer: C: Error using rsamtools to extract DNA sequences
... Found the problem! The indexFA should take the file path (e.g. here as indexFA("~/Desktop/test_genome/test.fa")). ...
written 9 months ago by hwu1210
Error using rsamtools to extract DNA sequences
... Hi, I am testing how to use rsamtools to extract DNA sequences from a fasta file. The testing fasta (as test.fa) is very simple: >scaffold_0 AAACGCGTTAGAGGCCTAACACGAGGCAGCTTCATGCTGCAGGTCACTCTAGAGGACCCAGCGATCTGCT I used GRanges to create a GRanges object: gr <- GRanges(seqnames = "scaffol ...
rsamtools written 9 months ago by hwu1210
Thermo Xcalibur RAW data to MGF
... I was wondering if there is any bioconductor package can convert the RAW file from Thermo Xcalibur to MGF file? If not, is there anything available for Mac OS? Thanks! ...
massspectrometry mass spectrometry written 9 months ago by hwu1210 • updated 9 months ago by Laurent Gatto1.1k
Comment: C: DESeq2 for Time course experiments
... Thanks so much your help, Michael! ...
written 12 months ago by hwu1210
Comment: C: DESeq2 for Time course experiments
... Hi Michael, I have 3 time points (0, 20 minutes, 1 hour) and 3 replicates each time point. Would you recommend to use factor or numeric values in this case? Thanks so much! ...
written 12 months ago by hwu1210
DESeq2 for Time course experiments
... I am learning to use DESeq2 for analyzing time course experiment from RNA-seq workflow: gene-level exploratory analysis and differential expression (section 10) and have a question about the "time" in the analysis. Should the time variable in the fission dataset be considered as factors or numeric v ...
deseq2 written 12 months ago by hwu1210 • updated 12 months ago by Michael Love22k
Comment: C: RNAseq analysis: how to compare two very different samples?
... These questions bothered me for a long time. Thanks so much, Aaron. I really appreciate your help.   ...
written 13 months ago by hwu1210
RNAseq analysis: how to compare two very different samples?
... Hi everyone, I heard that edgeR and DESeq2 assume that most genes in the samples are equally expressed, and only a small fraction of genes are differentially expressed. I was wondering how to compare two very different RNA samples. For example, one from muscle and the other from the liver. I know s ...
rnaseq edger deseq2 written 13 months ago by hwu1210 • updated 13 months ago by Aaron Lun22k

Latest awards to hwu12

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 361 users visited in the last hour