User: hwu12

gravatar for hwu12
hwu1210
Reputation:
10
Status:
New User
Location:
Last seen:
1 week ago
Joined:
1 year, 5 months ago
Email:
h****@ncsu.edu

Posts by hwu12

<prev • 19 results • page 1 of 2 • next >
1
vote
1
answer
54
views
1
answer
featureCounts for multiple features
... Hi, I am using the linux version of featureCounts, and I would like to count the number of reads in CDS, 5'UTR and 3'UTR. I was wondering if I should just count three times like: featureCounts -t CDS -g gene_id -a $GTF -o counts.txt $BAM featureCounts -t five_prime_UTR -g gene_id -a $GTF -o counts.t ...
featurecounts written 8 days ago by hwu1210 • updated 5 days ago by Wei Shi2.8k
0
votes
1
answers
72
views
1
answers
Answer: C: Error using rsamtools to extract DNA sequences
... Found the problem! The indexFA should take the file path (e.g. here as indexFA("~/Desktop/test_genome/test.fa")). ...
written 8 weeks ago by hwu1210
0
votes
1
answer
72
views
1
answer
Error using rsamtools to extract DNA sequences
... Hi, I am testing how to use rsamtools to extract DNA sequences from a fasta file. The testing fasta (as test.fa) is very simple: >scaffold_0 AAACGCGTTAGAGGCCTAACACGAGGCAGCTTCATGCTGCAGGTCACTCTAGAGGACCCAGCGATCTGCT I used GRanges to create a GRanges object: gr <- GRanges(seqnames = "scaffol ...
rsamtools written 8 weeks ago by hwu1210
2
votes
1
answer
93
views
1
answer
Thermo Xcalibur RAW data to MGF
... I was wondering if there is any bioconductor package can convert the RAW file from Thermo Xcalibur to MGF file? If not, is there anything available for Mac OS? Thanks! ...
massspectrometry mass spectrometry written 8 weeks ago by hwu1210 • updated 8 weeks ago by Laurent Gatto980
0
votes
1
answers
173
views
1
answers
Comment: C: DESeq2 for Time course experiments
... Thanks so much your help, Michael! ...
written 5 months ago by hwu1210
0
votes
1
answers
173
views
1
answers
Comment: C: DESeq2 for Time course experiments
... Hi Michael, I have 3 time points (0, 20 minutes, 1 hour) and 3 replicates each time point. Would you recommend to use factor or numeric values in this case? Thanks so much! ...
written 5 months ago by hwu1210
3
votes
1
answer
173
views
1
answer
DESeq2 for Time course experiments
... I am learning to use DESeq2 for analyzing time course experiment from RNA-seq workflow: gene-level exploratory analysis and differential expression (section 10) and have a question about the "time" in the analysis. Should the time variable in the fission dataset be considered as factors or numeric v ...
deseq2 written 5 months ago by hwu1210 • updated 5 months ago by Michael Love18k
0
votes
1
answers
204
views
1
answers
Comment: C: RNAseq analysis: how to compare two very different samples?
... These questions bothered me for a long time. Thanks so much, Aaron. I really appreciate your help.   ...
written 5 months ago by hwu1210
2
votes
1
answer
204
views
1
answer
RNAseq analysis: how to compare two very different samples?
... Hi everyone, I heard that edgeR and DESeq2 assume that most genes in the samples are equally expressed, and only a small fraction of genes are differentially expressed. I was wondering how to compare two very different RNA samples. For example, one from muscle and the other from the liver. I know s ...
rnaseq edger deseq2 written 6 months ago by hwu1210 • updated 6 months ago by Aaron Lun20k
0
votes
2
answers
319
views
2
answers
Comment: C: Generate 3' UTR and 5' UTR ranges from a gff file
... Thanks so much, Michael. This method can efficiently generate UTR ranges. However, is it possible to split them further to 5'UTR and 3'UTR? ...
written 6 months ago by hwu1210

Latest awards to hwu12

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 132 users visited in the last hour