User: hwu12

gravatar for hwu12
hwu1210
Reputation:
10
Status:
New User
Location:
Last seen:
3 months, 1 week ago
Joined:
2 years, 8 months ago
Email:
h****@ncsu.edu

Posts by hwu12

<prev • 20 results • page 1 of 2 • next >
0
votes
1
answer
861
views
1
answers
Comment: C: featureCounts for multiple features
... Thanks so much, Wei and Gordon!!! ...
written 15 months ago by hwu1210
3
votes
1
answer
861
views
1
answer
featureCounts for multiple features
... Hi, I am using the linux version of featureCounts, and I would like to count the number of reads in CDS, 5'UTR and 3'UTR. I was wondering if I should just count three times like: featureCounts -t CDS -g gene_id -a $GTF -o counts.txt $BAM featureCounts -t five_prime_UTR -g gene_id -a $GTF -o counts.t ...
featurecounts written 15 months ago by hwu1210 • updated 15 months ago by Wei Shi3.2k
0
votes
1
answer
308
views
1
answers
Answer: C: Error using rsamtools to extract DNA sequences
... Found the problem! The indexFA should take the file path (e.g. here as indexFA("~/Desktop/test_genome/test.fa")). ...
written 17 months ago by hwu1210
0
votes
1
answer
308
views
1
answer
Error using rsamtools to extract DNA sequences
... Hi, I am testing how to use rsamtools to extract DNA sequences from a fasta file. The testing fasta (as test.fa) is very simple: >scaffold_0 AAACGCGTTAGAGGCCTAACACGAGGCAGCTTCATGCTGCAGGTCACTCTAGAGGACCCAGCGATCTGCT I used GRanges to create a GRanges object: gr <- GRanges(seqnames = "scaffol ...
rsamtools written 17 months ago by hwu1210
2
votes
1
answer
854
views
1
answer
Thermo Xcalibur RAW data to MGF
... I was wondering if there is any bioconductor package can convert the RAW file from Thermo Xcalibur to MGF file? If not, is there anything available for Mac OS? Thanks! ...
massspectrometry mass spectrometry written 17 months ago by hwu1210 • updated 17 months ago by Laurent Gatto1.2k
0
votes
1
answer
349
views
1
answers
Comment: C: DESeq2 for Time course experiments
... Thanks so much your help, Michael! ...
written 20 months ago by hwu1210
0
votes
1
answer
349
views
1
answers
Comment: C: DESeq2 for Time course experiments
... Hi Michael, I have 3 time points (0, 20 minutes, 1 hour) and 3 replicates each time point. Would you recommend to use factor or numeric values in this case? Thanks so much! ...
written 20 months ago by hwu1210
3
votes
1
answer
349
views
1
answer
DESeq2 for Time course experiments
... I am learning to use DESeq2 for analyzing time course experiment from RNA-seq workflow: gene-level exploratory analysis and differential expression (section 10) and have a question about the "time" in the analysis. Should the time variable in the fission dataset be considered as factors or numeric v ...
deseq2 written 20 months ago by hwu1210 • updated 20 months ago by Michael Love25k
0
votes
1
answer
405
views
1
answers
Comment: C: RNAseq analysis: how to compare two very different samples?
... These questions bothered me for a long time. Thanks so much, Aaron. I really appreciate your help.   ...
written 21 months ago by hwu1210
2
votes
1
answer
405
views
1
answer
RNAseq analysis: how to compare two very different samples?
... Hi everyone, I heard that edgeR and DESeq2 assume that most genes in the samples are equally expressed, and only a small fraction of genes are differentially expressed. I was wondering how to compare two very different RNA samples. For example, one from muscle and the other from the liver. I know s ...
rnaseq edger deseq2 written 21 months ago by hwu1210 • updated 21 months ago by Aaron Lun25k

Latest awards to hwu12

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 162 users visited in the last hour