User: achaillon

gravatar for achaillon
achaillon0
Reputation:
0
Status:
New User
Last seen:
1 year, 11 months ago
Joined:
2 years, 1 month ago
Email:
a********@ucsd.edu

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by achaillon

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
305
views
0
answers
pairwise dist from bam file
... Hi I have deep sequencing output (thousands of reads in bam format) and I am looking for an efficient way to compute the pairwise distance (PWD) from reads with a minimum overlap I guess it has to be a multistep approach: (1) pairwise aln; (2) compute PWD and store the resulting matrix and (3) ext ...
bam pairwise diversity distance written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Comment: C: GenomicAlignments - extracting sequence signatures from bam file
... thanks! - I will give it a try and keep you informed (I posted another question for the other steps)   ...
written 2.1 years ago by achaillon0
0
votes
0
answers
335
views
0
answers
filter and trim large fasta/bam files
... Hi I am analyzing deep sequencing data and I would like to manipulate these large data  (>100,000 reads - can be either fasta or bam format) to do the followings: #1 - Exclude primer sequences (short strings of 25-30 nt)  e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' ...
bam fasta deep sequencing trim written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Comment: A: GenomicAlignments - extracting sequence signatures from bam file
... BTW, what would be the easiest ways (if any):  #1 - to exclude primer sequences (short strings of 25-30 nt) from my input fasta file within R e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' #2 - to filter out the short reads (< a 100 bp)? #3 - to exclude reverse orien ...
written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... actually, it occurs at the subsetting step (run for hour(s)) > windows <- subset(trim(resize(gr, window.size, fix="center"), + width < window.size)) ...
written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Hello I jus wanted to thank you all for your very precious help on this topic. Solution suggested by Martin works well for me - I also like the alternative one proposed by Michael but it was more computationally intensive given the size of my input files (up to several 100,000 of reads) Best, a ...
written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... That is just PERFECT and so much efficient than my loop attempt... thanks to all of you for these precious advices! a   ...
written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Here's what I've finally done... I am not proud of it and if anyone has a suggestion to make it more efficient, I am interested ;-)   MyOutPut <- NULL for(i in 1:seqnumber){ for(j in 6:(seqlength-6)){ if (myfasta2[i,j]=="C"){ CytosinePattern=myf ...
written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Is there a looping option that can work with matchPattern()? I tried a more trivial approach where 'myfile' is a large alignment of thousands of mapped reads and I converted it into a large matrix... It is not working but I wonder this is something one can consider (my guess is that it will be too ...
written 2.1 years ago by achaillon0
0
votes
12
answers
1.5k
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... My goal is to look for 'strings of 11 nucleotides centered by a C'  in all reads of my bam file (or converted into fasta) and not only in the reference seq... Is there a way to do that (that's why I tried  vmatchPattern above but it raised an error...) thanks in advance for all advices and suggesti ...
written 2.1 years ago by achaillon0

Latest awards to achaillon

Popular Question 23 months ago, created a question with more than 1,000 views. For GenomicAlignments - extracting sequence signatures from bam file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 210 users visited in the last hour