User: achaillon

gravatar for achaillon
achaillon0
Reputation:
0
Status:
New User
Location:
Last seen:
1 month, 1 week ago
Joined:
1 month, 2 weeks ago
Email:
a********@ucsd.edu

Posts by achaillon

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
58
views
0
answers
pairwise dist from bam file
... Hi I have deep sequencing output (thousands of reads in bam format) and I am looking for an efficient way to compute the pairwise distance (PWD) from reads with a minimum overlap I guess it has to be a multistep approach: (1) pairwise aln; (2) compute PWD and store the resulting matrix and (3) ext ...
bam pairwise diversity distance written 5 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Comment: C: GenomicAlignments - extracting sequence signatures from bam file
... thanks! - I will give it a try and keep you informed (I posted another question for the other steps)   ...
written 6 weeks ago by achaillon0
0
votes
0
answers
61
views
0
answers
filter and trim large fasta/bam files
... Hi I am analyzing deep sequencing data and I would like to manipulate these large data  (>100,000 reads - can be either fasta or bam format) to do the followings: #1 - Exclude primer sequences (short strings of 25-30 nt)  e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' ...
bam fasta deep sequencing trim written 6 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Comment: A: GenomicAlignments - extracting sequence signatures from bam file
... BTW, what would be the easiest ways (if any):  #1 - to exclude primer sequences (short strings of 25-30 nt) from my input fasta file within R e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' #2 - to filter out the short reads (< a 100 bp)? #3 - to exclude reverse orien ...
written 6 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... actually, it occurs at the subsetting step (run for hour(s)) > windows <- subset(trim(resize(gr, window.size, fix="center"), + width < window.size)) ...
written 6 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Hello I jus wanted to thank you all for your very precious help on this topic. Solution suggested by Martin works well for me - I also like the alternative one proposed by Michael but it was more computationally intensive given the size of my input files (up to several 100,000 of reads) Best, a ...
written 6 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... That is just PERFECT and so much efficient than my loop attempt... thanks to all of you for these precious advices! a   ...
written 6 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Here's what I've finally done... I am not proud of it and if anyone has a suggestion to make it more efficient, I am interested ;-)   MyOutPut <- NULL for(i in 1:seqnumber){ for(j in 6:(seqlength-6)){ if (myfasta2[i,j]=="C"){ CytosinePattern=myf ...
written 6 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Is there a looping option that can work with matchPattern()? I tried a more trivial approach where 'myfile' is a large alignment of thousands of mapped reads and I converted it into a large matrix... It is not working but I wonder this is something one can consider (my guess is that it will be too ...
written 6 weeks ago by achaillon0
0
votes
12
answers
230
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... My goal is to look for 'strings of 11 nucleotides centered by a C'  in all reads of my bam file (or converted into fasta) and not only in the reference seq... Is there a way to do that (that's why I tried  vmatchPattern above but it raised an error...) thanks in advance for all advices and suggesti ...
written 6 weeks ago by achaillon0

Latest awards to achaillon

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 257 users visited in the last hour