User: achaillon

gravatar for achaillon
achaillon0
Reputation:
0
Status:
New User
Location:
Last seen:
1 year ago
Joined:
1 year, 2 months ago
Email:
a********@ucsd.edu

Posts by achaillon

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
190
views
0
answers
pairwise dist from bam file
... Hi I have deep sequencing output (thousands of reads in bam format) and I am looking for an efficient way to compute the pairwise distance (PWD) from reads with a minimum overlap I guess it has to be a multistep approach: (1) pairwise aln; (2) compute PWD and store the resulting matrix and (3) ext ...
bam pairwise diversity distance written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Comment: C: GenomicAlignments - extracting sequence signatures from bam file
... thanks! - I will give it a try and keep you informed (I posted another question for the other steps)   ...
written 14 months ago by achaillon0
0
votes
0
answers
203
views
0
answers
filter and trim large fasta/bam files
... Hi I am analyzing deep sequencing data and I would like to manipulate these large data  (>100,000 reads - can be either fasta or bam format) to do the followings: #1 - Exclude primer sequences (short strings of 25-30 nt)  e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' ...
bam fasta deep sequencing trim written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Comment: A: GenomicAlignments - extracting sequence signatures from bam file
... BTW, what would be the easiest ways (if any):  #1 - to exclude primer sequences (short strings of 25-30 nt) from my input fasta file within R e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' #2 - to filter out the short reads (< a 100 bp)? #3 - to exclude reverse orien ...
written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... actually, it occurs at the subsetting step (run for hour(s)) > windows <- subset(trim(resize(gr, window.size, fix="center"), + width < window.size)) ...
written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Hello I jus wanted to thank you all for your very precious help on this topic. Solution suggested by Martin works well for me - I also like the alternative one proposed by Michael but it was more computationally intensive given the size of my input files (up to several 100,000 of reads) Best, a ...
written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... That is just PERFECT and so much efficient than my loop attempt... thanks to all of you for these precious advices! a   ...
written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Here's what I've finally done... I am not proud of it and if anyone has a suggestion to make it more efficient, I am interested ;-)   MyOutPut <- NULL for(i in 1:seqnumber){ for(j in 6:(seqlength-6)){ if (myfasta2[i,j]=="C"){ CytosinePattern=myf ...
written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... Is there a looping option that can work with matchPattern()? I tried a more trivial approach where 'myfile' is a large alignment of thousands of mapped reads and I converted it into a large matrix... It is not working but I wonder this is something one can consider (my guess is that it will be too ...
written 14 months ago by achaillon0
0
votes
12
answers
815
views
12
answers
Answer: A: GenomicAlignments - extracting sequence signatures from bam file
... My goal is to look for 'strings of 11 nucleotides centered by a C'  in all reads of my bam file (or converted into fasta) and not only in the reference seq... Is there a way to do that (that's why I tried  vmatchPattern above but it raised an error...) thanks in advance for all advices and suggesti ...
written 14 months ago by achaillon0

Latest awards to achaillon

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 279 users visited in the last hour