User: A

gravatar for A
A10
Reputation:
10
Status:
New User
Location:
Last seen:
1 day, 6 hours ago
Joined:
1 year, 1 month ago
Email:
a***********@gmail.com

Posts by A

<prev • 58 results • page 1 of 6 • next >
0
votes
0
answers
91
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... Ok thank you! Yes I am trying to manually blast the sequence to see if its there! ...
written 4 days ago by A10
0
votes
1
answers
41
views
1
answers
Comment: C: Can DEXSeq ouput be used directly as an input for IsoformSwitchAnalyzeR
... Thank you!! ...
written 8 days ago by A10
0
votes
1
answers
41
views
1
answers
Comment: C: Can DEXSeq ouput be used directly as an input for IsoformSwitchAnalyzeR
... Thank you so much for the quick response! I guess one quick follow up question... As im not too familiar with the command line alignment tools, can a feature counts output (counts over exons) be passed to IsoformSwitchAnalyzeR. Would that suffice as a counts table?   Thanks again! ...
written 8 days ago by A10
1
vote
1
answer
41
views
1
answer
Can DEXSeq ouput be used directly as an input for IsoformSwitchAnalyzeR
... Hi all,    Quick question, I was wondering if it possible to use directly, the output of a DEXSeq analysis and pass it in to analysis for isoformswitchanalyzeR? I have looked but cant find any information on this....   If so, which step can it be picked up from in the vignette?   Many thanks! ...
differential isoform usage isoform isoformswitchanalyzer written 8 days ago by A10 • updated 8 days ago by k.vitting.seerup30
0
votes
0
answers
91
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... apologies, align() output pasted correctly but posted as above, hope thats ok to read? >ENA|AAF03373|AAF03373.1 Zoanthus sp. fluorescent protein FP538 ATGGCTCATTCAAAGCACGGTCTAAAAGAAGAAATGACAATGAAATACCACATGGAAGGG TGCGTCAACGGACATAAATTTGTGATCACGGGCGAAGGCATTGGATATCCGTTCAAAGGG AAACAGACTATTAATCTGTGTGT ...
written 8 days ago by A10
0
votes
0
answers
91
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... aligh() output: |Function : Read alignment (RNA-Seq) || || Input file 1 : lane1_020_Ki_GTCTTGGC_L001_4198STDY7571463_R1.fastq.gz || || Input file 2 : lane1_020_Ki_GTCTTGGC_L001_4198STDY7571463_R2.fastq.gz || || Output file : alignResultsPE_1.BAM (BA ...
written 8 days ago by A10
0
votes
0
answers
91
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... Submittign differenet replies because of word count: Build index output: BuildIndex output: Rsubread 1.32.1 //=========================== indexBuilder setting ===========================\ || || || Index name : reference_index || || Index space : base-space || || One block index : yes || || R ...
written 8 days ago by A10
0
votes
0
answers
91
views
0
answers
Comment: C: mapping FASTQ files to single gene (fluorescent reporter)
... Thank you!! please see below! Apologies this was not done initially: Please see information requested below including all outputs: Session Info: R version 3.5.1 (2018-07-02) Platform: x86_64-apple-darwin15.6.0 (64-bit) Running under: macOS High Sierra 10.13.4 Matrix products: default BLAS: /Syst ...
written 8 days ago by A10
0
votes
0
answers
91
views
0
answers
mapping FASTQ files to single gene (fluorescent reporter)
... Hi all,  I have recently posted an Rsubread featurecounts related question, but I have another one, based on a quality control analysis I would like to do:  I am attempting to identify a fluorescent reporter that is driven of a specific promoter in our cells of interest which we then sort (based o ...
alignment rsubread align written 9 days ago by A10
0
votes
1
answers
88
views
1
answers
Comment: C: Featurecounts issue for counting exons: Not matching total counts mapped for spe
... thank you so much for your assistance! Really appreciate this, it has been so helpful! ...
written 9 days ago by A10

Latest awards to A

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 166 users visited in the last hour