Admin: Hervé Pagès

gravatar for Hervé Pagès
Hervé Pagès ♦♦ 14k
Reputation:
13,540
Status:
Trusted
Location:
United States
Last seen:
8 hours ago
Joined:
13 years, 6 months ago
Email:
h*****@fhcrc.org

Posts by Hervé Pagès

<prev • 1,634 results • page 1 of 164 • next >
2
votes
2
answers
214
views
2
answers
Answer: A: Build GPos from IPos
... Hi, This works with the latest devel version of GenomicRanges (1.37.13): ``` GPos("A", pos=IPos("3-8")) # StitchedGPos object with 9 positions and 0 metadata columns: # seqnames pos strand # # [1] A 3 * # [2] A 4 * # [3] ...
written 3 days ago by Hervé Pagès ♦♦ 14k
0
votes
1
answer
49
views
1
answers
Answer: A: Warning in makeTxDbFromGFF
... Hi, **The first 2 warnings** indicate that the file contains exons and CDS that were dropped because they couldn't be linked to a transcript. I just improved the warning message (the change is in GenomicFeatures 1.36.3) so it displays the number of exons or CDS that get dropped: ``` library(Genomic ...
written 3 days ago by Hervé Pagès ♦♦ 14k
0
votes
0
answers
35
views
0
answers
Comment: C: Embedded nul \0 in string with Biostrings::readAAStringSet()
... Hi, Such big files are insane! Ok, so I have access to a server with a lot of memory (384GB) so that should be enough. However I started the download of the `uniprot_trembl.fasta.gz` file (using `wget` from the Unix command line) and I see an ETA of more than 5h! The download speed I get is only 2 ...
written 4 days ago by Hervé Pagès ♦♦ 14k
0
votes
1
answer
72
views
1
answers
Comment: C: How to use Rsamtool or GenomicAlignments to calculate RAN-seq read coverage curv
... The `mode` argument controls how `summarizeOverlaps()` filters out reads. This argument takes a callback function that must have the following arguments: `features`, `reads`, `ignore.strand`, `inter.feature`, and must return a vector of counts _parallel_ to the `features` argument (i.e. with 1 count ...
written 9 days ago by Hervé Pagès ♦♦ 14k
0
votes
0
answers
44
views
0
answers
Comment: C: rbind VCF Two Objects Column Names Error
... Hi Dario, Hard to know without having access to these objects. DataFrame objects can be nested deep in `snv` and `ind` so this error could originate from trying to rbind some of these deeply nested objects. Anyway, it's hard to help you without being able to reproduce the error. Reproducible examp ...
written 14 days ago by Hervé Pagès ♦♦ 14k
1
vote
1
answer
72
views
1
answers
Answer: A: How to use Rsamtool or GenomicAlignments to calculate RAN-seq read coverage curv
... Hi Jiping, No high level tool for doing exactly that with Rsamtools or GenomicAlignments, AFAIK, but you should be able to use some lower level functionalities to get exactly what you want. Roughly, the following steps should get you there: #### 1. Load you reads in a GRangesList object ``` libra ...
written 14 days ago by Hervé Pagès ♦♦ 14k
0
votes
1
answer
2.3k
views
1
answers
Comment: C: GenomicAlignments: Inverting strand when counting using summarizeOverlaps
... Hi Ashu, I don't know how your BAM file was generated. Each aligner has its own settings and these setting must be understood and used carefully to reflect the protocol that was used. In the case of single end RNA-seq data, the question boils down to this: is the strand reported in the BAM file the ...
written 14 days ago by Hervé Pagès ♦♦ 14k
3
votes
1
answer
74
views
1
answers
Answer: A: Biostrings regex matching
... Hi Aditya, `matchPattern()` and family in Biostrings don't support the regex syntax. You would have to use `grep()` for that: ``` library(Biostrings) subject <- DNAStringSet(c("TTATATT", "CCCAACCCAAACCCAAAAAAT")) grep("A{3}", subject) # [1] 2 ``` or `regexpr()` or `gregexpr()`, depending on what ...
written 14 days ago by Hervé Pagès ♦♦ 14k
1
vote
1
answer
69
views
1
answers
Comment: C: Mimic Counting of HTSeq-count Using countOverlaps
... I thought the easy/standard way for counting uniquely mapped reads was to filter out _secondary alignments_. Any reason this cannot be used here? FWIW with Rsamtools/GenomicAlignments this can be done by setting the `isSecondaryAlignment` flag to `FALSE` when loading the reads from the BAM file e.g ...
written 25 days ago by Hervé Pagès ♦♦ 14k
2
votes
1
answer
67
views
1
answers
Answer: A: exonicParts vs. disjoinExons inconsistency in usage for DEXSeq - bug?
... Hi, Thanks for the report. The problem should be addressed in GenomicFeatures 1.36.1 (release) and 1.37.1 (devel). See [this commit](https://github.com/Bioconductor/GenomicFeatures/commit/a322aa838118a9dcd06add71009e93d19ca9c628) on GitHub for the details of the changes. GenomicFeatures 1.36.1 and ...
written 4 weeks ago by Hervé Pagès ♦♦ 14k

Latest awards to Hervé Pagès

Scholar 5 months ago, created an answer that has been accepted. For A: coverage() output SimpleRleList cannot be converted to GRanges
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: Calling coverage on GRanges object yields small negative values
Popular Question 5 months ago, created a question with more than 1,000 views. For how to obtain base counts from BAM file at specific genomic coordinates
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: Rsamtools v 1.99.6 installation error
Popular Question 5 months ago, created a question with more than 1,000 views. For RSQLite installation question
Scholar 5 months ago, created an answer that has been accepted. For A: Rsamtools v 1.99.6 installation error
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: Extracting Coordinates of startcodon from Grangeslist
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: Calling coverage on GRanges object yields small negative values
Scholar 5 months ago, created an answer that has been accepted. For A: coverage() output SimpleRleList cannot be converted to GRanges
Good Answer 6 months ago, created an answer that was upvoted at least 5 times. For A: how to extract "Gene type" from org.Mm.eg.db?
Popular Question 9 months ago, created a question with more than 1,000 views. For how to obtain base counts from BAM file at specific genomic coordinates
Teacher 9 months ago, created an answer with at least 3 up-votes. For A: Calling coverage on GRanges object yields small negative values
Scholar 9 months ago, created an answer that has been accepted. For A: coverage() output SimpleRleList cannot be converted to GRanges
Popular Question 9 months ago, created a question with more than 1,000 views. For unique, duplicated, order, etc... on a GRanges object
Popular Question 9 months ago, created a question with more than 1,000 views. For BioStrings for current R: RE: BSgenomeForge seed file - seqnames field
Teacher 9 months ago, created an answer with at least 3 up-votes. For A: Extracting Coordinates of startcodon from Grangeslist
Scholar 9 months ago, created an answer that has been accepted. For A: Extracting Coordinates of startcodon from Grangeslist
Teacher 10 months ago, created an answer with at least 3 up-votes. For A: Extracting Coordinates of startcodon from Grangeslist
Scholar 13 months ago, created an answer that has been accepted. For A: coverage() output SimpleRleList cannot be converted to GRanges
Scholar 13 months ago, created an answer that has been accepted. For A: Extracting Coordinates of startcodon from Grangeslist
Scholar 13 months ago, created an answer that has been accepted. For A: Feature request: syntax for dropping unused seqlevels in GRanges objects
Scholar 13 months ago, created an answer that has been accepted. For A: coverage() output SimpleRleList cannot be converted to GRanges
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: Extracting Coordinates of startcodon from Grangeslist
Teacher 24 months ago, created an answer with at least 3 up-votes. For A: extract subsequence(s) from DNAStringSet with getSeq

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 286 users visited in the last hour