User: svetlana.gorokhova

Reputation:
0
Status:
New User
Last seen:
5 months, 1 week ago
Joined:
1 year, 3 months ago
Email:
s*****************@univ-amu.fr

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by svetlana.gorokhova

<prev • 9 results • page 1 of 1 • next >
0
votes
1
answer
110
views
1
answers
Comment: C: error when using matchProbePair with BSgenome.Hsapiens.UCSC.hg19
... I now found everything I need to search Genomes for patterns in the excellent guide by Hervé Pages! https://bioconductor.org/packages/release/bioc/vignettes/BSgenome/inst/doc/GenomeSearching.pdf ...
written 5 months ago by svetlana.gorokhova0
0
votes
1
answer
110
views
1
answers
Comment: C: error when using matchProbePair with BSgenome.Hsapiens.UCSC.hg19
... It works now for chr11 example. I'll loop through the chromosomes to get the matches in the the whole genome. Thanks for your help! ...
written 5 months ago by svetlana.gorokhova0
0
votes
1
answer
110
views
1
answers
Comment: C: error when using matchProbePair with BSgenome.Hsapiens.UCSC.hg19
... before posting the question, I spent a lot of time on that help page and I tried many other combinations, inluding putting Hsapiens$chr11 (where my primers are) as subject, without success. Is it possible to use matchProbePair with the whole human genome? Is there a different package/function I shou ...
written 5 months ago by svetlana.gorokhova0
0
votes
1
answer
110
views
1
answer
error when using matchProbePair with BSgenome.Hsapiens.UCSC.hg19
... Hi, I'm trying to get genomic coordinates (hg19) for a pair of primers, but I'm getting an error. Here's the code used and the message received: ``` > library(Biostrings) > library(BiocManager) > library(BSgenome.Hsapiens.UCSC.hg19) > testF <- DNAString(x= "CACGGCCGCAGTCCCAATCA") & ...
bsgenome biostrings bsgenome.hsapiens.ucsc.hg19 matchprobepair written 5 months ago by svetlana.gorokhova0 • updated 5 months ago by James W. MacDonald51k
0
votes
4
answers
341
views
4
answers
Answer: A: GenomeInfoDbData not available for Mac
... __________________ ...
written 15 months ago by svetlana.gorokhova0
0
votes
4
answers
341
views
4
answers
Answer: A: GenomeInfoDbData not available for Mac
...   installing GenomeInfoDbData worked now, but ExomeDepth still gives error:                 ^ 2 warnings generated. clang -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG   -I/usr/local/include   -fPIC  -Wall -g -O2  -c VP_trig.c -o VP_trig.o clang -I"/Library/Frameworks/R.framework/ ...
written 15 months ago by svetlana.gorokhova0
0
votes
4
answers
341
views
4
answers
Answer: A: GenomeInfoDbData not available for Mac
... 2 warnings generated. clang -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG   -I/usr/local/include   -fPIC  -Wall -g -O2  -c VP_trig.c -o VP_trig.o clang -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG   -I/usr/local/include   -fPIC  -Wall -g -O2  -c VP_zeta.c -o VP_zet ...
written 15 months ago by svetlana.gorokhova0
0
votes
4
answers
341
views
4
answers
Answer: A: GenomeInfoDbData not available for Mac
... > biocLite("GenomeIndoDbData") BioC_mirror: http://bioconductor.org Using Bioconductor 3.7 (BiocInstaller 1.30.0), R 3.5.1 (2018-07-02). Installing package(s) ‘GenomeIndoDbData’ installation path not writeable, unable to update packages: foreign, survival Old packages: 'ExomeDepth' Update all/som ...
written 15 months ago by svetlana.gorokhova0
0
votes
4
answers
341
views
4
answers
GenomeInfoDbData not available for Mac
... Hi, I'm trying to install ExomeDepth on MacOS 10.13.5 using R 3.5.1. I installed all the necessary packages without problems exepts for GenomeInfoDbData. It seems not to be available for Mac on bioconductor... Please help me figure out how to solve this issue. thanks!   Error in install.packages ...
bioconductor genomeinfodbdata written 15 months ago by svetlana.gorokhova0

Latest awards to svetlana.gorokhova

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 211 users visited in the last hour