User: Steve Pederson

gravatar for Steve Pederson
Scholar ID:
Google Scholar Page
Last seen:
1 week, 2 days ago
9 years, 10 months ago

Posts by Steve Pederson

<prev • 11 results • page 1 of 2 • next >
News: BioCAsia, 29-30th November 2018, Melbourne, Australia
... The fourth Bioconductor Asia meeting ( will be held on Friday 30th November 2018 in Melbourne, Australia as a satellite event to ABACBS 2018 ( Speakers for the event include Prof Martin Morgan and A/Prof Stephanie Hic ...
news training conference written 7 months ago by Steve Pederson140 • updated 4 months ago by Gordon Smyth37k
Subsetting an EList Object doesn't subset $sample.weights
... Hi, When subsetting an EList object as output by voomWithQualityWeights() there is a list element $sample.weights. When subsetting using the single bracket method, this element returns the initial vector, instead of one that matches the subset. This doesn't seem to be the correct behaviour. Is thi ...
limma voom elist written 16 months ago by Steve Pederson140 • updated 16 months ago by Gordon Smyth37k
Gviz for long (plant) chromosomes using CSI index files
... Hi, I'm wanting to plot some alignments from Barley (Hordeum vulgare) which has 6 chromosomes beyond the limit of .bai index files (2^29). Are there any plans to enable .csi index files or is this a difficult ask? Currently the only real option is splitting chromosomes pre-alignment. Thanks, Stev ...
gviz written 2.3 years ago by Steve Pederson140
Job: Bioinformatics Researcher - University of Adelaide, South Australia
... Bioinformatics Specialist Research, Training and Research Support Fixed Term Position Available Immediately The School of Animal and Veterinary Sciences is one of four schools in the Faculty of Sciences. Located at the ...
job bioinformatician job australia written 3.4 years ago by Steve Pederson140
Job: Senior Bioinformatics Researcher - University of Adelaide, South Australia
... The School of Animal and Veterinary Sciences is one of four schools in the Faculty of Sciences. Located at the University's Roseworthy campus, approximately 50 km north of Adelaide, it is South Australia's only veterin ...
Job: Bioinformatics Research Associate, University of Adelaide
... We are seeking a motivated and experienced bioinformatician as part of the expansion of the University of Adelaide Bioinformatics Hub.  The mission of the Bioinformatics Hub is to provide support and training in state of the art bioinformatics to graduate students, researchers and academics at the U ...
job bioinformatics bioinformatician job australia written 3.8 years ago by Steve Pederson140 • updated 3.7 years ago by Makis Motakis20
Answer: A: Cannot load or update GO.db
... After a bit of playing around it's now installed & loading. Running biocValid(fix=TRUE) sorted it out. ...
written 4.0 years ago by Steve Pederson140
Cannot load or update GO.db
... Hi, I cannot load or update the package GO.db & can't quite figure a way out of it. I've tried as superuser & a regular user & the installation fails on both attempts. Below is the output after running "R --vanilla" as superuser Thanks, Steve > source(" ...
bioclite go.db written 4.0 years ago by Steve Pederson140
Question about 'updateCel' from package 'affxparser'
... Hi, I'm building an array analysis package using an MCMC process for each gene & am writing the key values (posterior quantiles, mean, sd etc) for each gene to disk using CEL files and the aroma.affymetrix architecture. However I've noticed that on rare occasion, the incorrect values are writ ...
cdf process written 7.7 years ago by Steve Pederson140
Calculating probe affinities directly from sequence data - GCRMA
... Hi, I'm working on some alternative ideas for fitting exon arrays & was wondering if there is a way to calculate theoretical probe affinities directly from sequence data such as: > myseq<-paste(sample(rep(c("A","C","T","G"),10),25),collapse="") > myseq [1] "ACTCACTTCGCTAAAACATTGGCTA ...
probe written 9.6 years ago by Steve Pederson140

Latest awards to Steve Pederson

Appreciated 16 months ago, created a post with more than 5 votes. For BioCAsia, 29-30th November 2018, Melbourne, Australia
Popular Question 3.4 years ago, created a question with more than 1,000 views. For Cannot load or update GO.db
Teacher 3.8 years ago, created an answer with at least 3 up-votes. For A: Cannot load or update GO.db


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 285 users visited in the last hour