User: Steve Pederson

Reputation:
60
Status:
Trusted
Location:
Australia
Website:
https://www.adelaide.e...
Last seen:
2 months, 2 weeks ago
Joined:
8 years, 5 months ago
Email:
s***************@adelaide.edu.au

Posts by Steve Pederson

<prev • 9 results • page 1 of 1 • next >
0
votes
0
answers
176
views
0
answers
Gviz for long (plant) chromosomes using CSI index files
... Hi, I'm wanting to plot some alignments from Barley (Hordeum vulgare) which has 6 chromosomes beyond the limit of .bai index files (2^29). Are there any plans to enable .csi index files or is this a difficult ask? Currently the only real option is splitting chromosomes pre-alignment. Thanks, Stev ...
gviz written 10 months ago by Steve Pederson60
0
votes
0
answers
430
views
0
answers
Job: Bioinformatics Researcher - University of Adelaide, South Australia
... http://careers.adelaide.edu.au/cw/en/job/494034/bioinformatics-researcher Bioinformatics Specialist Research, Training and Research Support Fixed Term Position Available Immediately The School of Animal and Veterinary Sciences is one of four schools in the Faculty of Sciences. Located at the ...
job bioinformatician job australia written 2.0 years ago by Steve Pederson60
0
votes
0
answers
401
views
0
answers
Job: Senior Bioinformatics Researcher - University of Adelaide, South Australia
... http://careers.adelaide.edu.au/cw/en/job/494038/senior-bioinformatics-researcher The School of Animal and Veterinary Sciences is one of four schools in the Faculty of Sciences. Located at the University's Roseworthy campus, approximately 50 km north of Adelaide, it is South Australia's only veterin ...
0
votes
1
answer
716
views
1
answer
Job: Bioinformatics Research Associate, University of Adelaide
... We are seeking a motivated and experienced bioinformatician as part of the expansion of the University of Adelaide Bioinformatics Hub.  The mission of the Bioinformatics Hub is to provide support and training in state of the art bioinformatics to graduate students, researchers and academics at the U ...
job bioinformatics bioinformatician job australia written 2.4 years ago by Steve Pederson60 • updated 2.3 years ago by Makis Motakis20
0
votes
1
answers
2.1k
views
1
answers
Answer: A: Cannot load or update GO.db
... After a bit of playing around it's now installed & loading. Running biocValid(fix=TRUE) sorted it out. ...
written 2.5 years ago by Steve Pederson60
4
votes
1
answer
2.1k
views
1
answer
Cannot load or update GO.db
... Hi, I cannot load or update the package GO.db & can't quite figure a way out of it. I've tried as superuser & a regular user & the installation fails on both attempts. Below is the output after running "R --vanilla" as superuser Thanks, Steve > source("http://bioconductor.org/bio ...
bioclite go.db written 2.5 years ago by Steve Pederson60
0
votes
0
answers
317
views
0
answers
Question about 'updateCel' from package 'affxparser'
... Hi, I'm building an array analysis package using an MCMC process for each gene & am writing the key values (posterior quantiles, mean, sd etc) for each gene to disk using CEL files and the aroma.affymetrix architecture. However I've noticed that on rare occasion, the incorrect values are writ ...
cdf process written 6.3 years ago by Steve Pederson60
0
votes
0
answers
346
views
0
answers
Calculating probe affinities directly from sequence data - GCRMA
... Hi, I'm working on some alternative ideas for fitting exon arrays & was wondering if there is a way to calculate theoretical probe affinities directly from sequence data such as: > myseq<-paste(sample(rep(c("A","C","T","G"),10),25),collapse="") > myseq [1] "ACTCACTTCGCTAAAACATTGGCTA ...
probe written 8.1 years ago by Steve Pederson60
0
votes
1
answers
368
views
1
answers
Comment: C: R and Microarray Analysis in R courses from Imperial College
... Hi John, I had some similar trouble with RCurl_0.95-1, but everything worked fine again when I rolled back to RCurl_0.94-1. The command listMarts() would work, but getBM() gave me a similar error. Hope that's vaguely useful, Steve john seers (IFR) wrote: > > Hi James > > Thanks for ...
written 8.5 years ago by Steve Pederson60

Latest awards to Steve Pederson

Popular Question 2.0 years ago, created a question with more than 1,000 views. For Cannot load or update GO.db
Teacher 2.4 years ago, created an answer with at least 3 up-votes. For A: Cannot load or update GO.db

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 313 users visited in the last hour