User: Christian.Stratowa@vie.boehringer-ingelheim.com

Reputation:
270
Status:
Trusted
Location:
Last seen:
11 years, 9 months ago
Joined:
16 years ago
Email:
c*****************@vie.boehringer-ingelheim.com

Posts by Christian.Stratowa@vie.boehringer-ingelheim.com

<prev • 27 results • page 1 of 3 • next >
0
votes
1
answer
646
views
1
answer
Help needed with aroma.affymetrix package to extract copy-numbers
... Dear all, Using aroma.affymetrix I have fitted a GLAD model and would like to extract the (relative) copy-numbers. Following the aroma-affymetrix website I did: # get cdf > chiptypes <- c("Mapping250K_Sty", "Mapping250K_Nsp") > cdf <- AffymetrixCdfFile$fromChipType(chiptypes[1]) # get ...
normalization cdf glad written 11.8 years ago by Christian.Stratowa@vie.boehringer-ingelheim.com270 • updated 11.8 years ago by Henrik Bengtsson2.4k
0
votes
0
answers
268
views
0
answers
Memory problem with 64bit R using PLASQ500k
... An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20080225/ 1683d364/attachment.pl ...
written 11.8 years ago by Christian.Stratowa@vie.boehringer-ingelheim.com270
0
votes
2
answers
861
views
2
answers
Comment: C: Help needed with CopyNumber analysis for Affymetrix 250K arrays
... Dear Henrik I have just downloaded and installed the aroma.affymetrix package, however, it seems that the package enforces a certain naming convention and directory structure, so I need some time to test it. Best regards Christian ============================================== Christian Stratowa, ...
written 11.9 years ago by Christian.Stratowa@vie.boehringer-ingelheim.com270
0
votes
2
answers
861
views
2
answers
Comment: C: Help needed with CopyNumber analysis for Affymetrix 250K arrays
... Dear Vincent Updating to oligo_1.3.7 and pd.mapping_0.4.1 did not help. I get the same error as before which I can repeat with justCRLMM: > crlmmOut <- crlmm(snprmaResults, correctionFile="outputEM.rda") M correction not provided. Calculating. Will take several minutes. Fitting mixture model ...
written 11.9 years ago by Christian.Stratowa@vie.boehringer-ingelheim.com270
0
votes
2
answers
861
views
2
answers
Help needed with CopyNumber analysis for Affymetrix 250K arrays
... Dear all, Until now I have done all CopyNumber (and LOH) analysis using Affymetrix CNAT4. However, I would prefer to use Bioconductor for this purpose, thus I have a couple of questions: 1, Normalization and summarization of mapping array 50K and 250K CEL- files: Currently, there seem to be only ...
normalization probe copynumber written 11.9 years ago by Christian.Stratowa@vie.boehringer-ingelheim.com270 • updated 11.9 years ago by Henrik Bengtsson2.4k
0
votes
0
answers
388
views
0
answers
justCRLMM vs crlmm
... An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20080128/ 5049506c/attachment.pl ...
written 11.9 years ago by Christian.Stratowa@vie.boehringer-ingelheim.com270
0
votes
0
answers
450
views
0
answers
FW: Does combineAffyBatch of package matchprobes elimi nate the wrong probe sets?
... Dear Wolfgang Thank you for your reply, I understand that you are busy, this seems to be a problem of everybody:-( In the case of "412_s_at" only one of 16 probe sequences are identical, i.e. GGAGCCAGGACACCTGCTCTCCGGC at position (202,259) vs (359,471). This means that one match is sufficient to ...
0
votes
1
answer
552
views
1
answers
Answer: A: Does combineAffyBatch of package matchprobes eliminate the wrong probe sets?
... Sorowly, until now I did not receive an answer to my question, so here is some more information: The main problem is that combineAffyBatch() adds probe set "412_s_at" to the list of common probe sets on U95A and U95Av2 although this probe set does NOT exist on U95Av2 but was replaced by probe set " ...
written 13.8 years ago by Christian.Stratowa@vie.boehringer-ingelheim.com270
0
votes
1
answer
552
views
1
answer
Does combineAffyBatch of package matchprobes eliminate the wrong probe sets?
... Maybe I am doing something wrong but when combining U95A and U95Av2 files using function combineAffyBatch() it seems that 197 probe sets from U95A and from U95Av2 are deleted although there are only 51 different probe sets. Furthermore, it seems that probe sets which are available on both U95A and U ...
0
votes
0
answers
672
views
0
answers
Error with CDF environment when using combineAffyBatch of pac kage matchprobes - mas5
... After adding >comb95 <- res$cdf rma normalization works well when using rma() or expresso(). Sorrowly, mas5 does not work, neither mas5() nor expresso(), in both cases I get the error: >dat.mas <- mas5(res$dat) background correcting...Error in as.vector(data) : NAs in foreign function c ...

Latest awards to Christian.Stratowa@vie.boehringer-ingelheim.com

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 154 users visited in the last hour