User: atisou

gravatar for atisou
New User
Last seen:
1 month, 1 week ago
2 years, 4 months ago

Posts by atisou

<prev • 21 results • page 1 of 3 • next >
Comment: C: Biostrings translate() function with alternative genetic code is not working for
... super, thanks Herve! H.   ...
written 6 weeks ago by atisou0
Biostrings translate() function with alternative genetic code is not working for first codon
... Hello, I would like to translate a bacterial DNA sequence into a protein using the GENETIC_CODE Id 11 (instead of the Standard Id 1) and below are the commands used: dna <- "TTGAGGATGACGAATCGTAACGTCGAATGGACTGATAATGCCTGGGATGAATATATCTATTGGCAGACACAGGATAAAAAGATACTTAAGCGTATTAATACCTTAATCAAAGAATGTCAG ...
biostrings genetic code translate written 9 weeks ago by atisou0 • updated 8 weeks ago by Hervé Pagès ♦♦ 12k
Comment: C: ChIPQC plotCoverageHist() and plotCC() not showing inputs
... Dear Thomas, Thanks for your reply. To achieve the input versus IP profile plots (CC and CoverageHist), I have to tweak around the design_table (separate comment posted previously) by adding the control samples as extra samples, in order to have the input samples to be taken into account: SampleI ...
written 5 months ago by atisou0
Comment: A: ChIPQC plotCoverageHist() and plotCC() not showing inputs
... Maybe we see the table better outside a code chunk? The design table: SampleID    Tissue    Factor    Condition    Treatment    Replicate    bamReads    ControlID    bamControl    Peaks    PeakCaller SGA_1    cord    E2F1    SGA    E2F1  1  SGA_1.bam input_SGA_1    SGA_input_1.bam    SGA_1_macs_pe ...
written 5 months ago by atisou0
ChIPQC plotCoverageHist() and plotCC() not showing inputs
... Hi, I have a ChIP-seq experimental design  consisting of 2 different conditions, with 3 biological replicates for each, thus N=6 different ChIP samples and with N=6 inputs samples (total N=12 samples). The design table: SampleID    Tissue    Factor    Condition    Treatment    Replicate    bamRea ...
chipqc input plotcoveragehist plotcc written 5 months ago by atisou0
Answer: A: DiffBind score values differ between MACS2 xls file and DBA() table
... Okey, thanks for the info dear Rory. Best, H, ...
written 6 months ago by atisou0
DiffBind score values differ between MACS2 xls file and DBA() table
... Hello, First thing first: thanks a lot for providing the community with such a useful ChIP-seq tool as DiffBind :) It seems I am missing something in how the score column values are computed in the 1st step of reading in the datasets with the dba() function. My design table is in a csv file, usin ...
diffbind score written 6 months ago by atisou0
Answer: A: DESeq2 performance information for counts tables with very large rows number
... Of course you are right and we are aware of these issues (we are not going to make DESeq2 say more than its purpose :) we are only doing some preliminary methods trials). "DESeq2 will scale linearly with number of rows." That's what I wanted to know. Thanks for your lights. H. ...
written 15 months ago by atisou0
DESeq2 performance information for counts tables with very large rows number
... Hello, I am testing some different approaches to analyse differential reads counts *per positions*, between 2 conditions with 2 replicates each.  I was thinking of using DESeq2, but modified in a way that the reads counts table would contain positions instead of genes. Therefore I would end up wit ...
deseq2 performance written 15 months ago by atisou0
Answer: A: DEXSeq output "Gene Model"
... So, as expected, the pictures (.png, .jpeg, ~50kb) don't seem to appear in my posts, probably because of rights issues (?). Apologies. ...
written 2.2 years ago by atisou0

Latest awards to atisou

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 150 users visited in the last hour