User: NS

gravatar for NS
NS10
Reputation:
10
Status:
New User
Location:
United States
Last seen:
9 months ago
Joined:
2 years, 8 months ago
Email:
n**********@yahoo.com

Posts by NS

<prev • 18 results • page 1 of 2 • next >
0
votes
1
answers
357
views
1
answers
Comment: C: Annotation in ExpressionSet object
... Thanks, but it does not solve my problem. I added data and my code to the question. Please take a look at them. ...
written 18 months ago by NS10
0
votes
1
answer
357
views
1
answer
Annotation in ExpressionSet object
... I have a matrix of gene expression which label of each sample and symbol of each gene is known. I wanna perform gtBroad in globaltest R-package. It needs to convert expression matrix to an ExpressionSet object with known Annotation. How can I do that while I have only the name of genes?   EDIT: Yo ...
globaltest expressionset written 18 months ago by NS10
0
votes
2
answers
329
views
2
answers
Comment: C: Mapping short reads to gene IDs in GPL9115
... Thank you so much @Martin, especially for mentioning the point about 'tpm' column. My major is computer science and I did not know it. ...
written 2.0 years ago by NS10
0
votes
1
answers
2.0k
views
1
answers
Comment: C: Biostrings throwing error
... @Martin Morgan I have such problem, too. Here is my session info: > sessionInfo() R version 3.2.0 (2015-04-16) Platform: x86_64-w64-mingw32/x64 (64-bit) Running under: Windows 8 x64 (build 9200) locale: [1] LC_COLLATE=English_United States.1252 LC_CTYPE=English_United States.1252 LC_MONE ...
written 2.0 years ago by NS10
0
votes
2
answers
329
views
2
answers
Comment: C: Mapping short reads to gene IDs in GPL9115
... Yeah, but I could not find a specific answer, e.g. R code or something like that. ...
written 2.0 years ago by NS10
0
votes
0
answers
239
views
0
answers
(Closed) Short reads mapping
... I have some RNA-Seq files which include such data: Tag CopyNumber TPM(Transcript Per Million) CATGAAGCTAACCCTGAAGGC 2 0.30 CATGGTGGAGTAGATGCTAGT 2 0.30 CATGCTCCACCCGGAAAAAAA 2 0.30 CATGCTCACACTCACTTCTCA 2 0.30 CATGTTATTCAGACATTACAT 2 0.30 CATGGGCTTCCAGTTGAATTT ...
rnaseq shortread written 2.0 years ago by NS10
0
votes
2
answers
329
views
2
answers
Mapping short reads to gene IDs in GPL9115
... I have downloaded GSE31617 data. As you can see its platform is GPL9115. In mRNA files, there are three columns: Tag CopyNumber TPM(Transcript Per Million) CATGTGGATGGGCTTCTTGTA 2 0.23 CATGGGGCCTTCCAGACCCAC ...
rnaseq gene id est written 2.0 years ago by NS10 • updated 2.0 years ago by Martin Morgan ♦♦ 20k
4
votes
2
answers
673
views
2
answers
Quality control on RNA-Seq (level 3) data from TCGA
... I have downloaded RNA_Seq files for mRNAs in level 3 format from TCGA database. These files contain "read_counts". Now, my supervisor emphasizes to do quality control steps, e.g. GC-content bias and length bias but I do not know anything about these procedures and how I can do them. My major is not ...
qualitycontrol rna-seq gc-content written 2.0 years ago by NS10 • updated 2.0 years ago by Matthew McCormack160
0
votes
1
answers
414
views
1
answers
Comment: C: Linear model after imputation (impute.knn function)
... In my knowledge, impute.knn just replaces NA values with a real values which have been calculated using KNN. ...
written 2.4 years ago by NS10
0
votes
1
answers
594
views
1
answers
Comment: C: Mapping of two different regions to one gene symbol
... I aim to make a gene-level matrix from CNV data. I mean a matrix like [genes x samples] which each entry shows Segment_mean value of the corresponding gene in sample. Does it make sense? ...
written 2.5 years ago by NS10

Latest awards to NS

Popular Question 21 months ago, created a question with more than 1,000 views. For Pipeline for analyzing CNV (SNP array) level 3 from TCGA
Popular Question 21 months ago, created a question with more than 1,000 views. For Mapping genome regions to gene symbols

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 194 users visited in the last hour