User: NS

gravatar for NS
NS50
Reputation:
50
Status:
New User
Location:
United States
Last seen:
3 months, 2 weeks ago
Joined:
4 years, 3 months ago
Email:
n**********@yahoo.com

Posts by NS

<prev • 18 results • page 1 of 2 • next >
0
votes
1
answer
768
views
1
answers
Comment: C: Annotation in ExpressionSet object
... Thanks, but it does not solve my problem. I added data and my code to the question. Please take a look at them. ...
written 3.1 years ago by NS50
0
votes
1
answer
768
views
1
answer
Annotation in ExpressionSet object
... I have a matrix of gene expression which label of each sample and symbol of each gene is known. I wanna perform gtBroad in globaltest R-package. It needs to convert expression matrix to an ExpressionSet object with known Annotation. How can I do that while I have only the name of genes?   EDIT: Yo ...
globaltest expressionset written 3.1 years ago by NS50
0
votes
2
answers
576
views
2
answers
Comment: C: Mapping short reads to gene IDs in GPL9115
... Thank you so much @Martin, especially for mentioning the point about 'tpm' column. My major is computer science and I did not know it. ...
written 3.6 years ago by NS50
0
votes
1
answer
2.7k
views
1
answers
Comment: C: Biostrings throwing error
... @Martin Morgan I have such problem, too. Here is my session info: > sessionInfo() R version 3.2.0 (2015-04-16) Platform: x86_64-w64-mingw32/x64 (64-bit) Running under: Windows 8 x64 (build 9200) locale: [1] LC_COLLATE=English_United States.1252 LC_CTYPE=English_United States.1252 LC_MONE ...
written 3.6 years ago by NS50
0
votes
2
answers
576
views
2
answers
Comment: C: Mapping short reads to gene IDs in GPL9115
... Yeah, but I could not find a specific answer, e.g. R code or something like that. ...
written 3.6 years ago by NS50
0
votes
0
answers
388
views
0
answers
(Closed) Short reads mapping
... I have some RNA-Seq files which include such data: Tag CopyNumber TPM(Transcript Per Million) CATGAAGCTAACCCTGAAGGC 2 0.30 CATGGTGGAGTAGATGCTAGT 2 0.30 CATGCTCCACCCGGAAAAAAA 2 0.30 CATGCTCACACTCACTTCTCA 2 0.30 CATGTTATTCAGACATTACAT 2 0.30 CATGGGCTTCCAGTTGAATTT ...
rnaseq shortread written 3.6 years ago by NS50
0
votes
2
answers
576
views
2
answers
Mapping short reads to gene IDs in GPL9115
... I have downloaded GSE31617 data. As you can see its platform is GPL9115. In mRNA files, there are three columns: Tag CopyNumber TPM(Transcript Per Million) CATGTGGATGGGCTTCTTGTA 2 0.23 CATGGGGCCTTCCAGACCCAC ...
rnaseq gene id est written 3.6 years ago by NS50 • updated 3.6 years ago by Martin Morgan ♦♦ 23k
4
votes
2
answers
1.2k
views
2
answers
Quality control on RNA-Seq (level 3) data from TCGA
... I have downloaded RNA_Seq files for mRNAs in level 3 format from TCGA database. These files contain "read_counts". Now, my supervisor emphasizes to do quality control steps, e.g. GC-content bias and length bias but I do not know anything about these procedures and how I can do them. My major is not ...
qualitycontrol rna-seq gc-content written 3.6 years ago by NS50 • updated 3.6 years ago by Matthew McCormack180
0
votes
1
answer
604
views
1
answers
Comment: C: Linear model after imputation (impute.knn function)
... In my knowledge, impute.knn just replaces NA values with a real values which have been calculated using KNN. ...
written 4.0 years ago by NS50
0
votes
1
answer
859
views
1
answers
Comment: C: Mapping of two different regions to one gene symbol
... I aim to make a gene-level matrix from CNV data. I mean a matrix like [genes x samples] which each entry shows Segment_mean value of the corresponding gene in sample. Does it make sense? ...
written 4.1 years ago by NS50

Latest awards to NS

Great Question 2.4 years ago, created a question with more than 5,000 views. For Mapping genome regions to gene symbols
Epic Question 2.4 years ago, created a question with more than 10,000 views. For Mapping genome regions to gene symbols
Popular Question 2.4 years ago, created a question with more than 1,000 views. For Quality control on RNA-Seq (level 3) data from TCGA
Popular Question 2.4 years ago, created a question with more than 1,000 views. For Mapping genome regions to gene symbols
Student 2.4 years ago, asked a question with at least 3 up-votes. For Mapping genome regions to gene symbols
Popular Question 3.4 years ago, created a question with more than 1,000 views. For Pipeline for analyzing CNV (SNP array) level 3 from TCGA
Popular Question 3.4 years ago, created a question with more than 1,000 views. For Mapping genome regions to gene symbols

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 275 users visited in the last hour