The editor has been updated to markdown! Please see more info at: Tutorial: Updated Support Site Editor

User: Konstantinos Yeles

New User
University of Salerno, Salerno, Italy
Scholar ID:
Google Scholar Page
Last seen:
17 hours ago
3 years, 4 months ago

PhD student

Posts by Konstantinos Yeles

<prev • 64 results • page 1 of 7 • next >
Comment: C: Ranges from a fasta file
... Thank you for the time you spent. Well, I try to make an object from 3 different files (the `fasta` with the sequences, the `gr_obj` with coordinates in the genome and another table with read sequences from smallRNAseq) in order to plot something like coverage but for each different sequence of ind ...
written 6 days ago by Konstantinos Yeles20
Comment: C: Ranges from a fasta file
... So names in the "fasta" file should have chr names and not something like smallRNA IDs e.g.: >piR-hsa-1 AGAAGACATTCGTGGAGGCGTC >piR-hsa-2 ACGCCTCCACGTAGTGTCTT >piR-hsa-3 ACGCCTCCACGAGTGTCTT ...
written 6 days ago by Konstantinos Yeles20
Comment: C: Ranges from a fasta file
... Thank you! Probably naive problem but I get : BSgenome::getSeq(fasta,gr_obj) Error: subscript contains invalid names table(names(gr_obj)%in%names(fasta)) TRUE 53 sum(names(fasta)%in%names(gr_obj)) [1] 29 any suggestions on where to identify the proble ...
written 6 days ago by Konstantinos Yeles20
Comment: C: Ranges from a fasta file
... rtracklayer::getSeq(fasta,gr_obj) Error in (function (classes, fdef, mtable) : unable to find an inherited method for function 'getSeq' for signature'DNAStringSet' > Biostrings::getSeq(fasta,gr_obj) Error in (function (classes, fdef, mtable) : unable to find an inh ...
written 6 days ago by Konstantinos Yeles20
Ranges from a fasta file
... I imported a fasta file using `readDNAStringSet` : fasta <- readDNAStringSet("~/piRbase.fa") fasta@ranges group start end width names 1 1 28720989 28721013 25 piR-hsa-1000547 2 1 42817439 42817467 29 piR-hsa-1483697 3 1 432 ...
biostrings genomicranges granges fasta written 6 days ago by Konstantinos Yeles20 • updated 6 days ago by Martin Morgan ♦♦ 22k
Comment: C: How to work with dplyr verbs in the colData slot of SingleCellExperiment objects
... Maybe, you find useful these two packages: 1. 2. ...
written 22 days ago by Konstantinos Yeles20
Comment: C: Normalization for small non-coding RNA and multi-factor design
... Dear Aaron, thank you for your answer!! Unfortunately, I just discussed with the experimentalist; the spike-ins haven't been added to each sample proportional to the number of cells. At least now I could suggest that for future experiments. But with this data, is it correct to proceed with the work ...
written 9 weeks ago by Konstantinos Yeles20
Comment: C: Data import with read.delim
... Dear Justin, If you still need to read several txt files at once, I recommend you to read this or this. Furthermore, if you are new to this please  consider reading at least one workflow on how to  perform downstream analysis. RNA-seq workflow: gene-level exploratory analysis and differential expre ...
written 9 weeks ago by Konstantinos Yeles20
Comment: C: Normalization for small non-coding RNA and multi-factor design
... design component1.tre component1.unt component2.tre component2.unt total.tre total.unt sample1 1 0 0 0 0 0 sample2 0 1 0 0 0 0 sample3 1 ...
written 9 weeks ago by Konstantinos Yeles20
Comment: C: Normalization for small non-coding RNA and multi-factor design
... Dear James, thank you for the answer and your suggestions on this matter. Sorry for the delayed reply. My question is not directly linked to the Scopus of this group, but I have to "gain the necessary expertise by myself". As I couldn't find any publication regarding the issue of  normalization be ...
written 9 weeks ago by Konstantinos Yeles20

Latest awards to Konstantinos Yeles


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 333 users visited in the last hour