User: Konstantinos Yeles

Reputation:
20
Status:
New User
Location:
University of Salerno, Salerno, Italy
Scholar ID:
Google Scholar Page
Last seen:
3 hours ago
Joined:
4 years ago
Email:
y*****************@gmail.com

PhD student

Posts by Konstantinos Yeles

<prev • 67 results • page 1 of 7 • next >
0
votes
0
answers
106
views
0
answers
Comment: C: Rsubread malloc(): memory corruption
... **Thank you very much!! I run it and this is what I get:** > alignmentmRNA <- align(index = path, + readfile1 = data, + #readfile2 = "./QC/QC_fastp/COLO205_CGATGTAT_L006_R2_001.fastq.gz", + type = "rna", + input_format = "FASTQ", + output ...
written 6 weeks ago by Konstantinos Yeles20
0
votes
0
answers
106
views
0
answers
Comment: C: Rsubread malloc(): memory corruption
... **I'm using** Virtual box 6.0.10 r132072(Qt5.6.1) **host machine:** CentOS Linux release 7.6.1810 (Core) NAME="CentOS Linux" VERSION="7 (Core)" ID="centos" ID_LIKE="rhel fedora" VERSION_ID="7" PRETTY_NAME="CentOS Linux 7 (Core)" ANSI_COLOR="0;31" CPE_NAME="cpe: ...
written 6 weeks ago by Konstantinos Yeles20
0
votes
0
answers
106
views
0
answers
Rsubread malloc(): memory corruption
... **Dear Bioconductor, I'm trying to use Rsubread in an Ubuntu virtual machine:** DISTRIB_ID=Ubuntu DISTRIB_RELEASE=18.04 DISTRIB_CODENAME=bionic DISTRIB_DESCRIPTION="Ubuntu 18.04.2 LTS" NAME="Ubuntu" VERSION="18.04.2 LTS (Bionic Beaver)" ID=ubuntu ID_LIKE=debian P ...
rsubread align malloc written 6 weeks ago by Konstantinos Yeles20
0
votes
1
answer
288
views
1
answers
Comment: C: Ranges from a fasta file
... Thank you for the time you spent. Well, I try to make an object from 3 different files (the `fasta` with the sequences, the `gr_obj` with coordinates in the genome and another table with read sequences from smallRNAseq) in order to plot something like coverage but for each different sequence of ind ...
written 8 months ago by Konstantinos Yeles20
0
votes
1
answer
288
views
1
answers
Comment: C: Ranges from a fasta file
... So names in the "fasta" file should have chr names and not something like smallRNA IDs e.g.: >piR-hsa-1 AGAAGACATTCGTGGAGGCGTC >piR-hsa-2 ACGCCTCCACGTAGTGTCTT >piR-hsa-3 ACGCCTCCACGAGTGTCTT ...
written 8 months ago by Konstantinos Yeles20
0
votes
1
answer
288
views
1
answers
Comment: C: Ranges from a fasta file
... Thank you! Probably naive problem but I get : BSgenome::getSeq(fasta,gr_obj) Error: subscript contains invalid names table(names(gr_obj)%in%names(fasta)) TRUE 53 sum(names(fasta)%in%names(gr_obj)) [1] 29 any suggestions on where to identify the proble ...
written 8 months ago by Konstantinos Yeles20
0
votes
1
answer
288
views
1
answers
Comment: C: Ranges from a fasta file
... rtracklayer::getSeq(fasta,gr_obj) Error in (function (classes, fdef, mtable) : unable to find an inherited method for function 'getSeq' for signature'DNAStringSet' > Biostrings::getSeq(fasta,gr_obj) Error in (function (classes, fdef, mtable) : unable to find an inh ...
written 8 months ago by Konstantinos Yeles20
5
votes
1
answer
288
views
1
answer
Ranges from a fasta file
... I imported a fasta file using `readDNAStringSet` : fasta <- readDNAStringSet("~/piRbase.fa") fasta@ranges group start end width names 1 1 28720989 28721013 25 piR-hsa-1000547 2 1 42817439 42817467 29 piR-hsa-1483697 3 1 432 ...
biostrings genomicranges granges fasta written 8 months ago by Konstantinos Yeles20 • updated 8 months ago by Martin Morgan ♦♦ 23k
0
votes
1
answer
203
views
1
answers
Comment: C: How to work with dplyr verbs in the colData slot of SingleCellExperiment objects
... Maybe, you find useful these two packages: 1. https://github.com/sa-lee/plyranges 2. https://github.com/const-ae/tidygenomics ...
written 8 months ago by Konstantinos Yeles20
0
votes
1
answer
368
views
1
answers
Comment: C: Normalization for small non-coding RNA and multi-factor design
... Dear Aaron, thank you for your answer!! Unfortunately, I just discussed with the experimentalist; the spike-ins haven't been added to each sample proportional to the number of cells. At least now I could suggest that for future experiments. But with this data, is it correct to proceed with the work ...
written 10 months ago by Konstantinos Yeles20

Latest awards to Konstantinos Yeles


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 367 users visited in the last hour