(x,y) coordinates and probe intensity
1
0
Entering edit mode
Ashley Lin ▴ 20
@ashley-lin-1144
Last seen 11.3 years ago
Dear group, I know this issue has been discussed before, but I had a hard time figuring out how to associate the intensity of a probe in CEL file with the x, y coordinates of the probes in the chip. For example, in Affymetrix U133A chip, the first probe is: >probe:HG-U133A_2:1007_s_at:416:177; Interrogation_Position=3330; Antisense; CACCCAGCTGGTCCTGTGGATGGGA where 416 is x coordinate and 177 is y coordinate on the chip. But when I use the following command, >cel<-ReadAffy() # there is only one CELfile in the folder >pmindex(cel)[1] I got the location information of the probe set 1007_s_at : $"1007_s_at" [1] 129340 213420 396671 82246 430968 427082 432610 72465 432865 99501 [11] 504952 443862 341432 198778 463575 10989 But none of the following equations that mentioned in the list before can fit into these numbers >(Textual description of makecdfenv): j = x*nrow + y + 1 >(Textual description of affy, p.26): j = x*nrow y + 1 (sic!) j = Probe.Y * >nrow + Probe.X + 1 (for the perfect match) >jmm = Probe.Y * nrow + Probe.X + 2 (for the mismatch) Does nrow refer to the row number of the batch file? Here ncol(intensity(cel))=1, nrow(intensity(cel))=506944 Can anybody tell me how this works please? Thank you very much, Ashley _________________________________________________________________ Don’t just search. Find. Check out the new MSN Search!
probe affy probe affy • 982 views
ADD COMMENT
0
Entering edit mode
@james-w-macdonald-5106
Last seen 10 days ago
United States
Ashley Lin wrote: > Dear group, > > I know this issue has been discussed before, but I had a hard time > figuring out how to associate the intensity of a probe in CEL file with > the x, y coordinates of the probes in the chip. > > For example, in Affymetrix U133A chip, the first probe is: > >> probe:HG-U133A_2:1007_s_at:416:177; Interrogation_Position=3330; >> Antisense; > > CACCCAGCTGGTCCTGTGGATGGGA > > where 416 is x coordinate and 177 is y coordinate on the chip. > > But when I use the following command, > >> cel<-ReadAffy() # there is only one CELfile in the folder >> pmindex(cel)[1] > > > I got the location information of the probe set 1007_s_at : > > $"1007_s_at" > [1] 129340 213420 396671 82246 430968 427082 432610 72465 432865 99501 > [11] 504952 443862 341432 198778 463575 10989 The problem here is that you are looking at the hgu133a2probe package (designed for the HG-U133A version 2 chip), but comparing to data from the HG-U133A chip. If you look at data from the correct probe package you get: > as.data.frame(hgu133aprobe)[1,] sequence x y Probe.Set.Name Probe.Interrogation.Position 1 CACCCAGCTGGTCCTGTGGATGGGA 467 181 1007_s_at and using the correct xy2i function, I get > xy2i(467, 181) [1] 129340 Best, Jim > > But none of the following equations that mentioned in the list before > can fit into these numbers > >> (Textual description of makecdfenv): j = x*nrow + y + 1 >> (Textual description of affy, p.26): j = x*nrow y + 1 (sic!) j = >> Probe.Y * nrow + Probe.X + 1 (for the perfect match) >> jmm = Probe.Y * nrow + Probe.X + 2 (for the mismatch) > > > Does nrow refer to the row number of the batch file? Here > ncol(intensity(cel))=1, nrow(intensity(cel))=506944 > > Can anybody tell me how this works please? > > Thank you very much, > Ashley > > _________________________________________________________________ > Don?t just search. Find. Check out the new MSN Search! > > > -------------------------------------------------------------------- ---- > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor -- James W. MacDonald Affymetrix and cDNA Microarray Core University of Michigan Cancer Center 1500 E. Medical Center Drive 7410 CCGC Ann Arbor MI 48109 734-647-5623
ADD COMMENT

Login before adding your answer.

Traffic: 818 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6