I am trying to use the crlmm package to import and analyze idat data from the Infinium CytoSNP-850K v1.2 BeadChip platform. Since there is no annotation package for it, I am using the option 'nopackage' and importing the annotation from an adapted manifest file. However, it seems I have an issue in the "gender" verification step (most probably with the YIndex), which blocks the import of the data. Here is the commands I am using:

library(crlmm)
library(ff)


samplesheet = read.csv("samplesTest.csv", header=TRUE, as.is=TRUE)

anno<-data.frame(read.csv("Manifest.850K.csv", header=TRUE, as.is=TRUE))

arrayNames <- file.path(datadir, unique(samplesheet[, "SentrixPosition"]))

arrayInfo <- list(barcode=NULL, position="SentrixPosition")

batch <- rep("1", nrow(samplesheet))

cnSet <- crlmmIllumina(sampleSheet=samplesheet, gender=samplesheet$gender, arrayNames=arrayNames, arrayInfoColNames=arrayInfo, highDensity=TRUE, call.method='krlmm', cdfName="nopackage", batch=batch, anno=anno, genome="hg19", copynumber=TRUE, nopackage.norm="loess", verbose=TRUE)

Here is the head of the annotation file:

chromosome  position    featureNames    isSnp   IlmnID  IlmnStrand  SNP     AddressA_ID     AlleleA_ProbeSeq    AddressB_ID     AlleleB_ProbeSeq    GenomeBuild     chr     MapInfo     Ploidy  Species     Source  SourceVersion   SourceStrand
1   157255396   rs1000073   TRUE    rs1000073-131_T_R_1893958059    TOP     [A/G]   95804186    ACCTAGCACTATTTTCTAGTGCTCCATCTCTTAGCAGGGACTCTGTTCAG  

    37  1   157255396   diploid     Homo sapiens    dbSNP   131     BOT
1   114471189   rs1000528   TRUE    rs1000528-138_B_R_2276261971    BOT     [T/C]   89693853    AAAGCCAAATGACTTCCCTTAAAAGGTACTTCAGCGCATTTTACACAAAT  

    37  1   114471189   diploid     Homo sapiens    dbSNP   138     TOP
4   190223523   rs10006955  TRUE    rs10006955-131_B_F_1893959315   BOT     [T/C]   5731264     CCTGCCCCCCTCCACCCCGATCTTGGTCTAGTTTTAGCCATATCACTTGT  

    37  4   190223523   diploid     Homo sapiens    dbSNP   131     BOT
4   153765098   rs10007643  TRUE    rs10007643-138_B_F_2276262148   BOT     [T/C]   98627830    ACACGGGATTTGTGCCCTCCCCTGACTTGTGGCCAGGAGGCTTCTACCAC  

    37  4   153765098   diploid     Homo sapiens    dbSNP   138     BOT
4   182218143   rs10018479  TRUE    rs10018479-138_T_R_2276262914   TOP     [A/C]   64751192    ACTTCAGGCCAAAAAAGCACAGAGATACAAAAGACATGACAATATCCCTG  

    37  4   182218143   diploid     Homo sapiens    dbSNP   138     BOT
4   25119575    rs10018563  TRUE    rs10018563-138_B_F_2276262922   BOT     [T/C]   20725290    GTGGTCATGGGCCAGCAGTGTGGGCACGCCCTAGGGATTTGCTAGAGATG  

    37  4   25119575    diploid     Homo sapiens    dbSNP   138     BOT
4   182048302   rs10020564  TRUE    rs10020564-138_B_F_2276263071   BOT     [T/C]   95780854    GAGAGAATGCACCACAAGAACAAGCAAATTGAATGTAGTGACAAACAGAG  

    37  4   182048302   diploid     Homo sapiens    dbSNP   138     BOT
4   123095703   rs10021037  TRUE    rs10021037-138_T_R_2276263103   TOP     [A/G]   81660971    GAAAGAACAGAGAAAGAGAAGGAACCTGTTATAGGAAGGAAAAAACAGCA  

    37  4   123095703   diploid     Homo sapiens    dbSNP   138     BOT
4   85281687    rs10021127  TRUE    rs10021127-138_T_R_2276263109   TOP     [A/C]   33720106    GTTGGATATCTACTATGTGATTAAAAAAAACGCATATATAACCACAGGCA  

    37  4   85281687    diploid     Homo sapiens    dbSNP   138     BOT

and this is the output of the analysis if I include the gender information:

Instantiate CNSet container.
path arg not set.  Assuming files are in local directory, or that complete path is provided
Initializing container for genotyping and copy number estimation
Processing sample stratum 1 of 1
'path' arg not set.  Assuming files are in local directory, or that complete path is provided in 'arrayNames'
Finished preprocessing.
Begin genotyping...
Start computing log-ratios
 -- Processing segment 1 out of 3
 -- Processing segment 2 out of 3
 -- Processing segment 3 out of 3
Leaving out non-variant SNPs
Start calculating 3-cluster parameters
Done calculating 3-cluster parameters
Start calculating 2-cluster parameters
Done calculating 2-cluster parameters
Start calculating 1-cluster parameters
Done calculating 1-cluster parameters
Done calculating platform-specific coefficients to predict number of clusters
Start predicting number of clusters
Done predicting number of clusters
Start assigning calls
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done assigning calls
Start computing confidence scores
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done computing confidence scores
Start imputing gender
Start computing average log-intensities
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done computing average log-intensities
Error in apply(Sy, 1, function(x) { : dim(X) must have a positive length

or if I don't include the gender information:

.............as above

Start computing confidence scores
 -- Processing segment 1 out of 2
 -- Processing segment 2 out of 2
Done computing confidence scores
Start verifying SNPs on Chromosome Y
Error in callsChrY[, male] : incorrect number of dimensions

An idea of what am I doing wrong?

Many thanks for your help,