I'm trying to create a '.db' package for agilent (Agilent-027114 Genotypic Technology designed Custom Human Whole Genome 8x60k Microarray) using this file. But when running this:

makeDBPackage('HUMANCHIP_DB',
              affy = FALSE,
              prefix = 'Agilent027114',
              fileName = 'D:/Tania_2/PhD/microarray_platform_anno/A-GEOD-13252Filled.adf.txt', 
              baseMapType = 'gb',
              outputDir = '.',
              author = 'Bioconductor',
              chipName = 'Agilent-027114 Genotypic Technology designed Custom Human Whole Genome 8x60k Microarray',
              manufacturer = 'Agilent',
              manufacturerUrl = 'http://www.agilent.com')

I am getting this error:

baseMapType is gb or gbNRef
Prepending Metadata
Creating Genes table
Error: NOT NULL constraint failed: genes.gene_id

I tried to replace empty spaces by NAs on the file. Removed rows with NAs in gene id. Change the columns names, but still get same error. Now the file is like this:

Probe_Set   Reporter.Sequence   gene_id
GT_44k_23_P100001   ATCTCATGGAAAAGCTGGATTCCTCTGCCTTACGCAGAAACACCCGGGCTCCATCTGCCA    NM_207446
GT_44k_23_P100011   TCAAGTATTGGCCTGACATAGAGTCCTTAAGACAAGCAAAGACAAGCAAGGCAAGCACGT    NM_005829
GT_44k_23_P100022   ATGTCGGCTGTGGAGGGTTAAAGGGATGAGGCTTTCCTTTGTTTAGCAAATCTGTTCACA    NM_014848

What am I doing wrong?

I can't find the documentation presently, but you need a two-column text file for the input file, with no headers. Which I think is different from what you have.

## read in
> z <- read.table("C:/Users/jmacdon/Desktop/A-GEOD-13252.adf.txt", TRUE, skip = 15, sep = "\t")
## write out
> write.table(z[,-2], "basemap", sep = "\t", quote = FALSE, row.names = FALSE, col.names = FALSE)
## make package
> makeDBPackage("HUMANCHIP_DB", affy = FALSE, prefix = "agilent027114", fileName = "basemap", baseMapType = "gbNRef",outputDir = ".", author = "me",  manufacturer = "Agilent", chipName = "agilent027114", version = "0.0.1")
baseMapType is gb or gbNRef
Prepending Metadata
Creating Genes table
Appending Probes
Found 46864 Probe Accessions
Appending Gene Info
Found 39904 Gene Names
Found 39904 Gene Symbols
Appending Chromosomes
Appending Cytogenetic Locations
Appending Omim
Appending RefSeq
Appending Pubmed
Appending Unigene
Appending ChrLengths
Appending 3 GO tables
Appending 3 GO ALL tables
Appending KEGG
Appending EC
Appending Chromosome Locations
Appending Pfam
Appending Prosite
Appending Alias
Appending Ensembl
Appending Uniprot
Appending Metadata 


simplifying probes table
dropping redundant data
Creating package in ./agilent027114.db 
There were 50 or more warnings (use warnings() to see the first 50)
## installify
> install.packages("agilent027114.db/", repos = NULL, type = "source")
Installing package into 'C:/Users/jmacdon/AppData/Roaming/R/win-library/4.0'
(as 'lib' is unspecified)
* installing *source* package 'agilent027114.db' ...
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
  converting help for package 'agilent027114.db'
    finding HTML links ... done
    agilent027114ACCNUM                     html  
    agilent027114ALIAS2PROBE                html  
    agilent027114BASE                       html  
    agilent027114CHR                        html  
    agilent027114CHRLENGTHS                 html  
    agilent027114CHRLOC                     html  
    agilent027114ENSEMBL                    html  
    agilent027114ENTREZID                   html  
    agilent027114ENZYME                     html  
    agilent027114GENENAME                   html  
    agilent027114GO                         html  
    agilent027114MAP                        html  
    agilent027114MAPCOUNTS                  html  
    agilent027114OMIM                       html  
    agilent027114ORGANISM                   html  
    agilent027114PATH                       html  
    agilent027114PFAM                       html  
    agilent027114PMID                       html  
    agilent027114PROSITE                    html  
    agilent027114REFSEQ                     html  
    agilent027114SYMBOL                     html  
    agilent027114UNIGENE                    html  
    agilent027114UNIPROT                    html  
    agilent027114_dbconn                    html  
** building package indices
** testing if installed package can be loaded from temporary location
*** arch - i386
*** arch - x64
** testing if installed package can be loaded from final location
*** arch - i386
*** arch - x64
** testing if installed package keeps a record of temporary installation path
* DONE (agilent027114.db)
>