Hi, Xiaoyue, The released version of lumi Annotation packages (names started with lumixxx) from Bioconductor were based on the EntrezID information provided by Illumina and built by Annbuilder package. As a result, some probes do not have EntrezID information. We will build the nuID annotation packages by blasting RefSeq very soon. Currently, we provide a web service for nuID annotation. Please visit this website to retrieve annotation of the nuIDs or probe sequences. http://www.basic.northwestern.edu/nuID/illumina/ Pan On 12/27/07 3:26 PM, "Zhao, Xiaoyue" <zhaox at="" cshl.edu=""> wrote: > Hi Pan, > > Sorry that I have to bother you one more question. The following probe > sequence corresponds to a very important gene NANOG. Why is that there is no > match after I use lookUp function? It was from the Beadstudio output. > >> data <- "lumiMouseV1" >> what <- "ENTREZID" >> seq <- 'TCTACCAGTCCCAAACAAAAGCTCTCAAGTCCTGAGGCTGACAAGGGCCC' >> x <- seq2id(seq) >> lookUp(x,data=data,what=what) > $x3FLVAQCd0LXinhCpU > [1] NA > > Thanks a lot, > Xiaoyue > > >