Question: another quick question about Illumina annotation
0
gravatar for Pan Du
11.7 years ago by
Pan Du1.2k
Pan Du1.2k wrote:
Hi, Xiaoyue, The released version of lumi Annotation packages (names started with lumixxx) from Bioconductor were based on the EntrezID information provided by Illumina and built by Annbuilder package. As a result, some probes do not have EntrezID information. We will build the nuID annotation packages by blasting RefSeq very soon. Currently, we provide a web service for nuID annotation. Please visit this website to retrieve annotation of the nuIDs or probe sequences. http://www.basic.northwestern.edu/nuID/illumina/ Pan On 12/27/07 3:26 PM, "Zhao, Xiaoyue" <zhaox at="" cshl.edu=""> wrote: > Hi Pan, > > Sorry that I have to bother you one more question. The following probe > sequence corresponds to a very important gene NANOG. Why is that there is no > match after I use lookUp function? It was from the Beadstudio output. > >> data <- "lumiMouseV1" >> what <- "ENTREZID" >> seq <- 'TCTACCAGTCCCAAACAAAAGCTCTCAAGTCCTGAGGCTGACAAGGGCCC' >> x <- seq2id(seq) >> lookUp(x,data=data,what=what) > $x3FLVAQCd0LXinhCpU > [1] NA > > Thanks a lot, > Xiaoyue > > >
annotation annbuilder lumi • 586 views
ADD COMMENTlink written 11.7 years ago by Pan Du1.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 158 users visited in the last hour