Hi all, With the affy package, I can have the signal(pm or mm) for all the probe for one probeSet. For example (if my affbatch "af" is from two HU133A .CEL) > pm(af,"1007_s_at") a1 a2 1007_s_at1 713.0 575.3 1007_s_at2 ... ... 1007_s_at16 ... .... On an other hand, I can have the sequence and the position for the differents probe of a given probe set : POG TARGET RESIDUES POSITIONX POSITIONY 1 3330 1007_s_at CACCCAGCTGGTCCTGTGGATGGGA 467 181 2 3443 1007_s_at GCCCCACTGGACAACACTGATTCCT 531 299 3 3512 1007_s_at TGGACCCCACTGGCTGAGAATCTGG 86 557 4 3563 1007_s_at AAATGTTTCCTTGTGCCTGCTCCTG 365 115 ... 16 3878 1007_s_at ATATATGGACCTAGCTTGAGGCAAT 308 15 and my problem is how I can link the "probename" (1007_s_at1) to the corresponding sequence ?. The sequence of 1007_s_at1 is "CACC..." or "GCCC.." or etc... ? Is there a available relation between the "number" of the probe in the Affy package and the position ? Tanks for your help. L. buffat

Hi Laurent > ... how I can link the "probename" (1007_s_at1) to the corresponding > sequence ?. The sequence of 1007_s_at1 is "CACC..." or "GCCC.." or > etc... ? Is there a available relation between the "number" of the probe > in the Affy package and the position ? The mapping between probe sequences/positions (e.g. in the probe packages, or in the data tables from Affymetrix) and the pm and mm intensities is through the xy2i function: > print.data.frame(hgu95av2probe[1000,]) sequence x y Probe.Set.Name 1000 GGTCTACGTCCGAGAGTGAGTGGCC 387 565 1057_at Probe.Interrogation.Position Target.Strandedness 1000 411 Antisense > xy2i(387, 565) [1] 361988 > exprs(Dilution)[xy2i(387, 565), ] ..will give you the expression values of that probe The reverse mapping is obtained by 'i2xy'. The two functions also take vector arguments. There are 3 caveats: 1. Presently, the functions 'pm' and 'mm' from the affy package are not well integrated with this procedure. Suggestions are welcome. 2. There is still a slight bug in the functions 'xy2i' and 'i2xy' that come with the CDF packages on the webpage. The bug has already been corrected in the package 'makecdfenv' that produces the CDF packages. It only concerns probe cells at the very rightmost edge of the chip, thus should not be critical. The packages will be rebuilt soon. See the thread in the mailing list: https://www.stat.math.ethz.ch/pipermail/bioconductor/2003-August/00222 9.html 3. There are related functions 'xy2indices' and 'indices2xy', which work just as well. However, they use a different numbering convention for the x and y coordinates (you have to add 1). Best regards Wolfgang

For this kind of stuff, 'indexProbes' might be more convenient. Ex: i.pm <- indexProbes(af, "1007_s_at", "pm")[[1]] xy.pm <- indices2xyi.pm, abatch=af) ## note the '+1'. The Affymetrix coordinates start at 0 while they start at 1 ## in the affy package seq.pm <- xy.pm[,1] == theProbeSet$POSITIONX + 1) & xy.pm[,2] == theProbeSet$POSITIONY + 1) Hopin' it helps, L. On Mon, Sep 15, 2003 at 09:25:26AM +0200, laurent buffat wrote: > > Hi all, > > With the affy package, I can have the signal(pm or mm) for all the probe for > one probeSet. > For example (if my affbatch "af" is from two HU133A .CEL) > > > pm(af,"1007_s_at") > > a1 a2 > 1007_s_at1 713.0 575.3 > 1007_s_at2 ... > ... > 1007_s_at16 ... .... > > On an other hand, I can have the sequence and the position for the > differents probe of a given probe set : > > POG TARGET RESIDUES POSITIONX POSITIONY > 1 3330 1007_s_at CACCCAGCTGGTCCTGTGGATGGGA 467 181 > 2 3443 1007_s_at GCCCCACTGGACAACACTGATTCCT 531 299 > 3 3512 1007_s_at TGGACCCCACTGGCTGAGAATCTGG 86 557 > 4 3563 1007_s_at AAATGTTTCCTTGTGCCTGCTCCTG 365 115 > ... > 16 3878 1007_s_at ATATATGGACCTAGCTTGAGGCAAT 308 15 > > and my problem is how I can link the "probename" (1007_s_at1) to the > corresponding sequence ?. The sequence of 1007_s_at1 is "CACC..." or > "GCCC.." or etc... ? > Is there a available relation between the "number" of the probe in the Affy > package and the position ? > > Tanks for your help. > > L. buffat > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://www.stat.math.ethz.ch/mailman/listinfo/bioconductor -- -------------------------------------------------------------- Laurent Gautier CBS, Building 208, DTU PhD. Student DK-2800 Lyngby,Denmark tel: +45 45 25 24 89 http://www.cbs.dtu.dk/laurent