Hi, I'm working on some alternative ideas for fitting exon arrays & was wondering if there is a way to calculate theoretical probe affinities directly from sequence data such as: > myseq<-paste(sample(rep(c("A","C","T","G"),10),25),collapse="") > myseq [1] "ACTCACTTCGCTAAAACATTGGCTA" I can find the spline coefficients using "affinity.spline.coefs", but it looks like you can only perform the calculations via > compute.affinities.local(myAffyBatch) Currently, you can't specify exon arrays as an AffyBatch, but the sequences for each probe are available in a probe_tab file. Thanks, Steve