Question: reverse complement or no reverse complemnt on biomaRt / biomart.org
0
gravatar for Tefina Paloma
10.0 years ago by
Tefina Paloma220
Tefina Paloma220 wrote:
James W. MacDonald <jmacdon at="" ...=""> writes: > > The flanking sequence isn't reverse complemented in R, it is reported > exactly as it is received from the Biomart server. > > I am a bit confused here as well; AFAICT, the sequence for the 5' flank > and UTR are identical from all sources (Ensembl, Biomart and biomaRt). > > 5' flank: > Ensembl > > ccgccgccagcgcccccgccgcagcgcccgcggcccggctcctctcactt > > Biomart > > CCGCCGCCAGCGCCCCCGCCGCAGCGCCCGCGGCCCGGCTCCTCTCACTT > > biomaRt > > CCGCCGCCAGCGCCCCCGCCGCAGCGCCCGCGGCCCGGCTCCTCTCACTT > > 5'UTR > > Ensembl > > CACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGGTCCTTCCACC > > Biomart > > CACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGGTCCTTCCACC > > biomaRt > > CACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGGTCCTTCCACC > > Best, > > Jim Dear Jim, Do you know if these sequences are sense or antisense? If you export the sequence via biomart (via the webpage), you get the following: >ENST00000280193 utr5:KNOWN_protein_coding CGGGGAAGGGGAGGGAGGAGGGGGACGAGGGCTCTGGCGGGTTTGGAGGGGCTGAACATC GCGGGGTGTTCTGGTGTCCCCCGCCCCGCCTCTCCAAAAAGCTACACCGACGCGGACCGC GGCGGCGTCCTCCCTCGCCCTCGCTTCACCTCGCGGGCTCCGAATGCGGGGAGCTCGGAT GTCCGGTTTCCTGTGAGGCTTTTACCTGACACCCGCCGCCTTTCCCCGGCACTGGCTGGG AGGGCGCCCTGCAAAGTTGGGAACGCGGAGCCCCGGACCCGCTCCCGCCGCCTCCGGCTC GCCCAGGGGGGGTCGCCGGGAGGAGCCCGGGGGAGAGGGACCAGGAGGGGCCCGCGGCCT CGCAGGGGCGCCCGCGCCCCCACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGG TCCTTCCACC >5' Flanking sequence chromosome:GRCh37:4:177713896:177713945:1 AAGTGAGAGGAGCCGGGCCGCGGGCGCTGCGGCGGGGGCGCTGGCGGCGG So, in contrast to the web-view, the flanking sequence is reverse complemented. Basically it is just a problem of correct definition and assignment. So which sequences are sense and which are antisense. Best, Tefina
biomart • 499 views
ADD COMMENTlink modified 10.0 years ago • written 10.0 years ago by Tefina Paloma220
Answer: reverse complement or no reverse complemnt on biomaRt / biomart.org
0
gravatar for James W. MacDonald
10.0 years ago by
United States
James W. MacDonald51k wrote:
Hi Tefina, Tefina Paloma wrote: > Dear Jim, > > Do you know if these sequences are sense or antisense? > If you export the sequence via biomart (via the webpage), you get the following: > >> ENST00000280193 utr5:KNOWN_protein_coding > CGGGGAAGGGGAGGGAGGAGGGGGACGAGGGCTCTGGCGGGTTTGGAGGGGCTGAACATC > GCGGGGTGTTCTGGTGTCCCCCGCCCCGCCTCTCCAAAAAGCTACACCGACGCGGACCGC > GGCGGCGTCCTCCCTCGCCCTCGCTTCACCTCGCGGGCTCCGAATGCGGGGAGCTCGGAT > GTCCGGTTTCCTGTGAGGCTTTTACCTGACACCCGCCGCCTTTCCCCGGCACTGGCTGGG > AGGGCGCCCTGCAAAGTTGGGAACGCGGAGCCCCGGACCCGCTCCCGCCGCCTCCGGCTC > GCCCAGGGGGGGTCGCCGGGAGGAGCCCGGGGGAGAGGGACCAGGAGGGGCCCGCGGCCT > CGCAGGGGCGCCCGCGCCCCCACCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGG > TCCTTCCACC > >> 5' Flanking sequence chromosome:GRCh37:4:177713896:177713945:1 > AAGTGAGAGGAGCCGGGCCGCGGGCGCTGCGGCGGGGGCGCTGGCGGCGG How are you getting this? I get the same thing as the web service, as I noted yesterday: > getSequence(id = c("ENST00000280193"), type ="ensembl_transcript_id",seqType = "transcript_flank", upstream = 50, mart =mart) transcript_flank ensembl_transcript_id 1 CCGCCGCCAGCGCCCCCGCCGCAGCGCCCGCGGCCCGGCTCCTCTCACTT ENST00000280193 > sessionInfo() R version 2.10.0 Under development (unstable) (2009-09-21 r49780) i386-pc-mingw32 locale: [1] LC_COLLATE=English_United States.1252 [2] LC_CTYPE=English_United States.1252 [3] LC_MONETARY=English_United States.1252 [4] LC_NUMERIC=C [5] LC_TIME=English_United States.1252 attached base packages: [1] stats graphics grDevices datasets utils methods base other attached packages: [1] biomaRt_2.1.0 annaffy_1.17.2 affycoretools_1.17.4 [4] KEGG.db_2.3.0 GO.db_2.3.0 RSQLite_0.7-2 [7] DBI_0.2-4 AnnotationDbi_1.7.17 affy_1.23.9 [10] Biobase_2.5.6 loaded via a namespace (and not attached): [1] affyio_1.13.5 annotate_1.23.2 Biostrings_2.13.50 [4] Category_2.11.4 gcrma_2.17.2 genefilter_1.25.7 [7] GOstats_2.11.3 graph_1.23.6 GSEABase_1.7.3 [10] IRanges_1.3.89 limma_2.19.4 preprocessCore_1.7.9 [13] RBGL_1.21.12 RCurl_0.98-1 splines_2.10.0 [16] survival_2.35-7 tools_2.10.0 XML_2.5-1 [19] xtable_1.5-5 Best, Jim > > So, in contrast to the web-view, the flanking sequence is reverse complemented. > Basically it is just a problem of correct definition and assignment. > So which sequences are sense and which are antisense. > > Best, > Tefina > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician Douglas Lab University of Michigan Department of Human Genetics 5912 Buhl 1241 E. Catherine St. Ann Arbor MI 48109-5618 734-615-7826
ADD COMMENTlink written 10.0 years ago by James W. MacDonald51k
Answer: reverse complement or no reverse complemnt on biomaRt / biomart.org
0
gravatar for Tefina Paloma
10.0 years ago by
Tefina Paloma220
Tefina Paloma220 wrote:
I apologize for giving such a vague description. If I go to the ensemble page, click on "Mine Ensembl with BioMart", chose as database ensembl 56, Homo Sapiens, GRCh37, filter by ENST00000280193, click on results, and then click on the ENST00000280193 which leads to the transcript summary of this ensembl. Then, on the left hand side, I click on "export data" and I chose "fasta format", "feature strand", "flanking sequence" and "5utr". By doing this, I get the sequences I posted. Best, Tefina
ADD COMMENTlink written 10.0 years ago by Tefina Paloma220
Tefina Paloma wrote: > > I apologize for giving such a vague description. > > If I go to the ensemble page, click on "Mine Ensembl with BioMart", chose as > database ensembl 56, Homo Sapiens, GRCh37, filter by ENST00000280193, click on > results, and then click on the ENST00000280193 which leads to the transcript > summary of this ensembl. Then, on the left hand side, I click on "export data" > and I chose "fasta format", "feature strand", "flanking sequence" and "5utr". > By doing this, I get the sequences I posted. That looks like a bug in that export wizard. It doesn't matter which strand you choose for the 5' UTR, you get the (correct) reverse strand regardless. However, if you choose either feature strand or reverse strand, you get the forward strand (the reverse complement of the correct 5' flanking region). If you choose forward strand, you still get the forward strand, but it is off the 3' end of the gene. Try pasting this into blat (http://genome.ucsc.edu/cgi-bin/hgBlat) to see what I mean. > biomaRt CCGCCGCCAGCGCCCCCGCCGCAGCGCCCGCGGCCCGGCTCCTCTCACTT > forward GTAGTTTTCGTTCATCATGTAAGATGATAATGGACTGAACTTAGCAGCTT > feature AAGTGAGAGGAGCCGGGCCGCGGGCGCTGCGGCGGGGGCGCTGGCGGCGG So the only correct results here are from biomaRt. Best, Jim > > Best, > Tefina > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- James W. MacDonald, M.S. Biostatistician Douglas Lab University of Michigan Department of Human Genetics 5912 Buhl 1241 E. Catherine St. Ann Arbor MI 48109-5618 734-615-7826
ADD REPLYlink written 10.0 years ago by James W. MacDonald51k
Answer: reverse complement or no reverse complemnt on biomaRt / biomart.org
0
gravatar for Tefina Paloma
10.0 years ago by
Tefina Paloma220
Tefina Paloma220 wrote:
Thanks a lot for your quick help, I am really thankful, best, Tefina
ADD COMMENTlink written 10.0 years ago by Tefina Paloma220
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 346 users visited in the last hour