help for mRNA decay rate
2
0
Entering edit mode
@alberto-goldoni-3477
Last seen 10.3 years ago
Dear all, i have a specific question, if i have a sequence of mRNA with some mutations, there is a tool in R that can tell me if the mRNA will codify or will transform in "mRNA decay"? Best regards and thanks to all. -- ----------------------------------------------------- Dr. Alberto Goldoni Bologna, Italy
• 1.1k views
ADD COMMENT
0
Entering edit mode
@kasper-daniel-hansen-2979
Last seen 18 months ago
United States
On Mon, Feb 15, 2010 at 1:30 PM, Alberto Goldoni < alberto.goldoni1975@gmail.com> wrote: > Dear all, > i have a specific question, if i have a sequence of mRNA with some > mutations, there is a tool in R that can tell me if the mRNA will > codify or will transform in "mRNA decay"? Such a tool does not exists in R. I would be doubtful that such a tool exists in general, and if it does, it will be very organism dependent. Even though a pathway such as NMD exists in most (higher) organisms, the method by which it recognizes aberrant transcripts is different between organisms and - for some organisms - poorly understood (and one could argue that we still don't understand the recognition process in humans). And this is just for the NMD pathway; there are several degradation pathways. Having said that, having something like an early stop codon introduced by a mutation probably points towards the transcript being degraded by NMD, but it is hard to know for sure (here, "early" is particular vague). You might also need to know the UTRs in addition to the coding sequence. Kasper [[alternative HTML version deleted]]
ADD COMMENT
0
Entering edit mode
Robert Castelo ★ 3.4k
@rcastelo
Last seen 12 days ago
Barcelona/Universitat Pompeu Fabra
hi, from the words "will codify" i understand you mean whether the mutations introduce one or more stop codons in-frame so that the non-sense mediated decay pathway would in principle degrade that mRNA. then, if the goal is simply to see whether you have one of those stop codons in-frame you may use the package Biostrings, run the following example: library(Biostrings) codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA" codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT" mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame)) translated_mRNA <- as.character(translate(mRNAwithStop)) if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) { cat("stop codon in-frame!\n") } else { cat("no stop codon in-frame!\n") } if your coding DNA includes the corresponding stop codon at the end of the coding sequence you would have to adapt this code to avoid detecting that "proper" stop codon as being in-frame. here is my session information: sessionInfo() R version 2.10.0 (2009-10-26) x86_64-unknown-linux-gnu locale: [1] C attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] Biostrings_2.14.8 IRanges_1.4.9 loaded via a namespace (and not attached): [1] Biobase_2.6.0 cheers, robert. On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote: > Dear all, > i have a specific question, if i have a sequence of mRNA with some > mutations, there is a tool in R that can tell me if the mRNA will > codify or will transform in "mRNA decay"? > > Best regards and thanks to all. >
ADD COMMENT
0
Entering edit mode
Dear All, first of all thanks for your help. For Robert: what i would like to know is if the amount of the mutations (1,2,3,4,.... many mutations for example) are enouth block the transcription process (and so we will have the mRNA decay), or may still encode. Best regards. 2010/2/17 Robert Castelo <robert.castelo at="" upf.edu="">: > hi, > > from the words "will codify" i understand you mean whether the mutations > introduce one or more stop codons in-frame so that the non-sense > mediated decay pathway would in principle degrade that mRNA. then, if > the goal is simply to see whether you have one of those stop codons > in-frame you may use the package Biostrings, run the following example: > > > library(Biostrings) > > codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA" > codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT" > mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame)) > translated_mRNA <- as.character(translate(mRNAwithStop)) > > if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) { > ?cat("stop codon in-frame!\n") > } else { > ?cat("no stop codon in-frame!\n") > } > > > if your coding DNA includes the corresponding stop codon at the end of > the coding sequence you would have to adapt this code to avoid detecting > that "proper" stop codon as being in-frame. > > here is my session information: > > sessionInfo() > R version 2.10.0 (2009-10-26) > x86_64-unknown-linux-gnu > > locale: > [1] C > > attached base packages: > [1] stats ? ? graphics ?grDevices utils ? ? datasets ?methods > base > > other attached packages: > [1] Biostrings_2.14.8 IRanges_1.4.9 > > loaded via a namespace (and not attached): > [1] Biobase_2.6.0 > > cheers, > robert. > > On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote: >> Dear all, >> i have a specific question, if i have a sequence of mRNA with some >> mutations, there is a tool in R that can tell me if the mRNA will >> codify or will transform in "mRNA decay"? >> >> Best regards and thanks to all. >> > > -- ----------------------------------------------------- Dr. Alberto Goldoni Bologna, Italy
ADD REPLY
0
Entering edit mode
hi Alberto, at this point i think your question is rather more directly related to the molecular biology of the cell and the regulatory mechanisms behind transcription and translation, than to a specific calculation you want to do. in this respect, unfortunately, i cannot offer you any further advice. cheers, robert. On Wed, 2010-02-17 at 10:29 +0100, Alberto Goldoni wrote: > Dear All, first of all thanks for your help. > > For Robert: > what i would like to know is if the amount of the mutations > (1,2,3,4,.... many mutations for example) are enouth block the > transcription process (and so we will have the mRNA decay), or may > still encode. > Best regards. > > 2010/2/17 Robert Castelo <robert.castelo at="" upf.edu="">: > > hi, > > > > from the words "will codify" i understand you mean whether the mutations > > introduce one or more stop codons in-frame so that the non-sense > > mediated decay pathway would in principle degrade that mRNA. then, if > > the goal is simply to see whether you have one of those stop codons > > in-frame you may use the package Biostrings, run the following example: > > > > > > library(Biostrings) > > > > codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA" > > codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT" > > mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame)) > > translated_mRNA <- as.character(translate(mRNAwithStop)) > > > > if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) { > > cat("stop codon in-frame!\n") > > } else { > > cat("no stop codon in-frame!\n") > > } > > > > > > if your coding DNA includes the corresponding stop codon at the end of > > the coding sequence you would have to adapt this code to avoid detecting > > that "proper" stop codon as being in-frame. > > > > here is my session information: > > > > sessionInfo() > > R version 2.10.0 (2009-10-26) > > x86_64-unknown-linux-gnu > > > > locale: > > [1] C > > > > attached base packages: > > [1] stats graphics grDevices utils datasets methods > > base > > > > other attached packages: > > [1] Biostrings_2.14.8 IRanges_1.4.9 > > > > loaded via a namespace (and not attached): > > [1] Biobase_2.6.0 > > > > cheers, > > robert. > > > > On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote: > >> Dear all, > >> i have a specific question, if i have a sequence of mRNA with some > >> mutations, there is a tool in R that can tell me if the mRNA will > >> codify or will transform in "mRNA decay"? > >> > >> Best regards and thanks to all. > >> > > > > > > >
ADD REPLY

Login before adding your answer.

Traffic: 645 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6