Dear all,
i have a specific question, if i have a sequence of mRNA with some
mutations, there is a tool in R that can tell me if the mRNA will
codify or will transform in "mRNA decay"?
Best regards and thanks to all.
--
-----------------------------------------------------
Dr. Alberto Goldoni
Bologna, Italy
On Mon, Feb 15, 2010 at 1:30 PM, Alberto Goldoni <
alberto.goldoni1975@gmail.com> wrote:
> Dear all,
> i have a specific question, if i have a sequence of mRNA with some
> mutations, there is a tool in R that can tell me if the mRNA will
> codify or will transform in "mRNA decay"?
Such a tool does not exists in R. I would be doubtful that such a
tool
exists in general, and if it does, it will be very organism dependent.
Even
though a pathway such as NMD exists in most (higher) organisms, the
method
by which it recognizes aberrant transcripts is different between
organisms
and - for some organisms - poorly understood (and one could argue that
we
still don't understand the recognition process in humans). And this
is
just for the NMD pathway; there are several degradation pathways.
Having said that, having something like an early stop codon introduced
by a
mutation probably points towards the transcript being degraded by NMD,
but
it is hard to know for sure (here, "early" is particular vague).
You might also need to know the UTRs in addition to the coding
sequence.
Kasper
[[alternative HTML version deleted]]
hi,
from the words "will codify" i understand you mean whether the
mutations
introduce one or more stop codons in-frame so that the non-sense
mediated decay pathway would in principle degrade that mRNA. then, if
the goal is simply to see whether you have one of those stop codons
in-frame you may use the package Biostrings, run the following
example:
library(Biostrings)
codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA"
codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT"
mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame))
translated_mRNA <- as.character(translate(mRNAwithStop))
if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) {
cat("stop codon in-frame!\n")
} else {
cat("no stop codon in-frame!\n")
}
if your coding DNA includes the corresponding stop codon at the end of
the coding sequence you would have to adapt this code to avoid
detecting
that "proper" stop codon as being in-frame.
here is my session information:
sessionInfo()
R version 2.10.0 (2009-10-26)
x86_64-unknown-linux-gnu
locale:
[1] C
attached base packages:
[1] stats graphics grDevices utils datasets methods
base
other attached packages:
[1] Biostrings_2.14.8 IRanges_1.4.9
loaded via a namespace (and not attached):
[1] Biobase_2.6.0
cheers,
robert.
On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote:
> Dear all,
> i have a specific question, if i have a sequence of mRNA with some
> mutations, there is a tool in R that can tell me if the mRNA will
> codify or will transform in "mRNA decay"?
>
> Best regards and thanks to all.
>
Dear All, first of all thanks for your help.
For Robert:
what i would like to know is if the amount of the mutations
(1,2,3,4,.... many mutations for example) are enouth block the
transcription process (and so we will have the mRNA decay), or may
still encode.
Best regards.
2010/2/17 Robert Castelo <robert.castelo at="" upf.edu="">:
> hi,
>
> from the words "will codify" i understand you mean whether the
mutations
> introduce one or more stop codons in-frame so that the non-sense
> mediated decay pathway would in principle degrade that mRNA. then,
if
> the goal is simply to see whether you have one of those stop codons
> in-frame you may use the package Biostrings, run the following
example:
>
>
> library(Biostrings)
>
> codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA"
> codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT"
> mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame))
> translated_mRNA <- as.character(translate(mRNAwithStop))
>
> if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) {
> ?cat("stop codon in-frame!\n")
> } else {
> ?cat("no stop codon in-frame!\n")
> }
>
>
> if your coding DNA includes the corresponding stop codon at the end
of
> the coding sequence you would have to adapt this code to avoid
detecting
> that "proper" stop codon as being in-frame.
>
> here is my session information:
>
> sessionInfo()
> R version 2.10.0 (2009-10-26)
> x86_64-unknown-linux-gnu
>
> locale:
> [1] C
>
> attached base packages:
> [1] stats ? ? graphics ?grDevices utils ? ? datasets ?methods
> base
>
> other attached packages:
> [1] Biostrings_2.14.8 IRanges_1.4.9
>
> loaded via a namespace (and not attached):
> [1] Biobase_2.6.0
>
> cheers,
> robert.
>
> On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote:
>> Dear all,
>> i have a specific question, if i have a sequence of mRNA with some
>> mutations, there is a tool in R that can tell me if the mRNA will
>> codify or will transform in "mRNA decay"?
>>
>> Best regards and thanks to all.
>>
>
>
--
-----------------------------------------------------
Dr. Alberto Goldoni
Bologna, Italy
hi Alberto,
at this point i think your question is rather more directly related to
the molecular biology of the cell and the regulatory mechanisms behind
transcription and translation, than to a specific calculation you want
to do. in this respect, unfortunately, i cannot offer you any further
advice.
cheers,
robert.
On Wed, 2010-02-17 at 10:29 +0100, Alberto Goldoni wrote:
> Dear All, first of all thanks for your help.
>
> For Robert:
> what i would like to know is if the amount of the mutations
> (1,2,3,4,.... many mutations for example) are enouth block the
> transcription process (and so we will have the mRNA decay), or may
> still encode.
> Best regards.
>
> 2010/2/17 Robert Castelo <robert.castelo at="" upf.edu="">:
> > hi,
> >
> > from the words "will codify" i understand you mean whether the
mutations
> > introduce one or more stop codons in-frame so that the non-sense
> > mediated decay pathway would in principle degrade that mRNA. then,
if
> > the goal is simply to see whether you have one of those stop
codons
> > in-frame you may use the package Biostrings, run the following
example:
> >
> >
> > library(Biostrings)
> >
> > codingDNAwithStopInFrame <- "CATATTTGAACTCATGAACGTGAA"
> > codingDNAwithStopInFrame <- "GTATAAACTTGAGTACTTGCACTT"
> > mRNAwithStop <- transcribe(DNAString(codingDNAwithStopInFrame))
> > translated_mRNA <- as.character(translate(mRNAwithStop))
> >
> > if (!is.na(match("*", unlist(strsplit(translated_mRNA, ""))))) {
> > cat("stop codon in-frame!\n")
> > } else {
> > cat("no stop codon in-frame!\n")
> > }
> >
> >
> > if your coding DNA includes the corresponding stop codon at the
end of
> > the coding sequence you would have to adapt this code to avoid
detecting
> > that "proper" stop codon as being in-frame.
> >
> > here is my session information:
> >
> > sessionInfo()
> > R version 2.10.0 (2009-10-26)
> > x86_64-unknown-linux-gnu
> >
> > locale:
> > [1] C
> >
> > attached base packages:
> > [1] stats graphics grDevices utils datasets methods
> > base
> >
> > other attached packages:
> > [1] Biostrings_2.14.8 IRanges_1.4.9
> >
> > loaded via a namespace (and not attached):
> > [1] Biobase_2.6.0
> >
> > cheers,
> > robert.
> >
> > On Mon, 2010-02-15 at 19:30 +0100, Alberto Goldoni wrote:
> >> Dear all,
> >> i have a specific question, if i have a sequence of mRNA with
some
> >> mutations, there is a tool in R that can tell me if the mRNA will
> >> codify or will transform in "mRNA decay"?
> >>
> >> Best regards and thanks to all.
> >>
> >
> >
>
>
>
