Entering edit mode
                    Paul Shannon
        
    
        ★
    
    1.1k
        @paul-shannon-578
        Last seen 11.2 years ago
        
    I wish to trim a variable length sequence from the end of many
thousands of DNAStrings in a DNAStringSet.
The sequence to be trimmed is any recognizable chunk of a solexa short
read adapter, which ends up on the end of, for example, 22nt miRNAs.
The adapter chunk might be found in the middle of a 35 base read, or
it might be closer to the end.  In every case, I want to delete every
base from the start of the adapter chunk to the end of the read.
I imagine there might be a BString operation equivalent to sed.  See
could be used ike this:
  echo 'CGAAGCGGGATGATCTATCTCGTATGCCGTCTTCT' | sed s/TCGTATGCCGTC.*$//
--> GAAGCGGGATGATCTATC
(where TCGTATGCCGTC is only part of the 21-base adapter, but is
probably a long enough portion to be representative)
Any way to do this with BStrings and friends?
Thanks!
 - Paul
                    
                
                