I did read the section on Loops-and-conditional-execution but I did not see any mention of using multiple lines. Ideally I read the whole R-intro. @Martin Morgan Thanks for your help. http://cran.fhcrc.org/doc/manuals/R-intro.html#Loops-and-conditional- execution *Vincent Davis 720-301-3003 * vincent@vincentdavis.net my blog <http: vincentdavis.net=""> | LinkedIn<http: www.linkedin.com="" in="" vincentdavis=""> On Mon, Apr 5, 2010 at 9:09 PM, Martin Morgan <mtmorgan@fhcrc.org> wrote: > Hi Vincent -- > > On 04/05/2010 07:57 PM, Vincent Davis wrote: > > I very new to R and having a little trouble with CdfEnvAffy, I am going > > thought the > > Might help to read through > > http://cran.fhcrc.org/doc/manuals/R-intro.html > > (also available by typing help.start() in to your R session). > > > Here are my steps > >> fasta.filename <- system.file("/Users/vmd/Dropbox/dna/toxodb/", > > "TgondiiME49Genomic_ToxoDB-6.0.fasta", package = "altcdfenvs") > >> con <- file(fasta.filename, open = "r") > > Warning message: > > In file(fasta.filename, open = "r") : > > file("") only supports open = "w+" and open = "w+b": using the former > > > > #### Not sure what to do about this error so I just removed, <open ==""> "r">, > > this seems to be ok > > > >> con <- file(fasta.filename) > > > > #### This is where I am really stuck > > > >> while (!is.null(fasta.seq$header)) {print(fasta.seq) fasta.seq <- > > read.FASTA.entry(con)} > > Error: unexpected symbol in "while (!is.null(fasta.seq$header)) > > {print(fasta.seq) fasta.seq" > > This is saying that you cannot write > > print(fasta.seq) fasta.seq <- read.FASTA.entry(con) > > on a single line -- it is a syntax error and would normally be written > on two separate lines > > while (!is.null(fastq.seq$header)) { > print(fasta.seq) > fasta.seq <- read.FASTA.entry(con) > } > > Martin > > > #### So I tried this and it is better but still not right > >> while (!is.null(fasta.seq$header)) {print(fasta.seq) (fasta.seq <- > > read.FASTA.entry(con))} > > FASTA sequence: > > >gnl|UG|Hs#S1730546 membrane-spanning 4-domains, subfamily A ... > > AACCCATTTCAACTGCCTATTCAGAGCATGCAGTAAGAGGAAATCCACCAAGTCTCAATA ... > > Error: attempt to apply non-function > > > > > > So I am not sure how to get this to work. > > Thanks > > Vincent > > > > > >> sessionInfo() > > R version 2.10.1 (2009-12-14) > > x86_64-apple-darwin9.8.0 > > > > locale: > > [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8 > > > > attached base packages: > > [1] stats graphics grDevices utils datasets methods base > > > > other attached packages: > > [1] altcdfenvs_2.8.0 hypergraph_1.18.0 graph_1.24.4 > > makecdfenv_1.24.0 affyio_1.14.0 > > [6] matchprobes_1.18.0 Biostrings_2.14.12 IRanges_1.4.16 > > AnnotationDbi_1.8.2 affy_1.24.2 > > [11] Biobase_2.6.1 > > > > loaded via a namespace (and not attached): > > [1] DBI_0.2-5 preprocessCore_1.8.0 RSQLite_0.8-4 > > tools_2.10.1 > > > > > > > > *Vincent Davis > > 720-301-3003 * > > vincent@vincentdavis.net > > my blog <http: vincentdavis.net=""> | > > LinkedIn<http: www.linkedin.com="" in="" vincentdavis=""> > > > > [[alternative HTML version deleted]] > > > > _______________________________________________ > > Bioconductor mailing list > > Bioconductor@stat.math.ethz.ch > > https://stat.ethz.ch/mailman/listinfo/bioconductor > > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > -- > Martin Morgan > Computational Biology / Fred Hutchinson Cancer Research Center > 1100 Fairview Ave. N. > PO Box 19024 Seattle, WA 98109 > > Location: Arnold Building M1 B861 > Phone: (206) 667-2793 > [[alternative HTML version deleted]]