Thank-you Wolfgang for your reply. I fear that I didn't understand that section of the vignettte so it didn't register as the section to return to when I got stuck. When I tried your second method with the package hgu95aprobe, I don't see the connection back to the ProbeID (sorry about the wrapping): > str(hgu95aprobe) Classes probetable and `data.frame': 199091 obs. of 6 variables: $ sequence :Class 'AsIs' chr [1:199091] "TCTCCTTTGCTGAGGCCTCCAGCTT" "AGGCCTCCAGCTTCAGGCAGGCCAA" "CCAGCTTCAGGCAGGCCAAGGCCTT" "AGCTCAGGTGGCCCCAGTTCAATCT" ... $ x : int 399 544 530 617 459 408 484 548 578 498 ... $ y : int 559 185 505 349 489 545 311 333 369 465 ... $ Probe.Set.Name :Class 'AsIs' chr [1:199091] "1000_at" "1000_at" "1000_at" "1000_at" ... $ Probe.Interrogation.Position: int 1367 1379 1385 1445 1523 1595 1649 1655 1667 1673 ... $ Target.Strandedness : Factor w/ 2 levels "Antisense","Sense": 1 1 1 1 1 1 1 1 1 1 ... To prepare a table of ProbeID versus AffyID either for the whole collection or a subset, would I rely on the x and y to give me the coordinates of the feature on the chip and then use the xy2i() function to compute an index, 'i', to extract a row from the AffyBatch object? Thanks, Mark ====================================================================== =============== On Monday 15 December 2003 02:56 pm, w.huber@dkfz-heidelberg.de wrote: > this is documented in the vignette to the affy package, section 7. > To repeat it here, you can get the probe set names by > > psets = ls(hgu95av2cdf) > > (replace "hgu95av" by whatever your chip name is). The indices of > the j-th probe set's PM and MM probes by > > get(psets[j], hgu95av2cdf) > > and use these to subset the exprs matrix of the AffyBatch object. > > Alternatively, a dataframe that maps probe Ids and probe set Ids (and > provides the sequence as well) is available in the probe packages, e.g. > hgu95av2probe. > > Best wishes > Wolfgang > > ------------------------------------- > Wolfgang Huber > Division of Molecular Genome Analysis > German Cancer Research Center > Heidelberg, Germany > Phone: +49 6221 424709 > Fax: +49 6221 42524709 > Http: www.dkfz.de/abt0840/whuber > ------------------------------------- > > On Mon, 15 Dec 2003, Mark Dalphin wrote: > > Hi, > > > > I'm trying to extract information from an AffyBatch object. I want to > > prepare a table which contains: > > > > AffyID ProbeID PM-1 PM-2 PM-3 ... > > > > Where: > > AffyID is also called the GeneName. > > ProbeID is the ID for the specific reporter on the chip. > > PM-1, PM-2, ... are the PerfectMatch intensities for several different > > chips which are part of the the expression set. > > > > I can see using the 'pm' method to extract most of this where the ProbeID > > and PM-1 will be row- and col-names in a matrix (this is great), but then > > I don't see how to associate the Affy-ID with ProbeID anywhere. A > > two-column data frame would be just fine. > > > > Any help would be appreciated. > > > > Thanks, > > Mark > > > > PS I am fairly familliar with R, but many of the data structures in > > BioConductor seem opaque to me. I believe this is due to the new S4 class > > structure being used, but I am not certain. Any pointers to how these > > data are represented and how to browse them would be appreciated; my old > > stand-by > > > > of str() is failing on these data: > > > str(spikein) > > > > List of 59 > > $ : int [1:59] 1 2 3 4 5 6 7 8 9 10 ... > > $ :Error in .subset2(x, i) : subscript out of bounds > > > > R version 1.8.0 under RedHat Linux 7.3 -- Mark Dalphin email: mdalphin@amgen.com Mail Stop: 29-2-A phone: +1-805-447-4951 (work) One Amgen Center Drive +1-805-375-0680 (home) Thousand Oaks, CA 91320 fax: +1-805-499-9955 (work)