Hi, I would like to report a bug in biomaRt service. If I use the function getBM and I am searching for UTRs or coding sequence as well as identifiers, I get them in scrambled order. Meaning, the content of columns does not correspond to their headers: library(biomaRt) ensembl=useMart("ensembl", dataset="mmusculus_gene_ensembl") getBM (attributes = c ("ensembl_gene_id ","ensembl_transcript_id ","coding "),filters ="ensembl_gene_id",values=c("ENSMUSG00000028661"),mart=ensembl) This will result in something like: ensembl_gene_id ATGGCCCCCGCCCGGGCCCGCCTGTCCCCCGCTCTCTGGGTCGTCACGGCCGCGGCGGCGGCCACCTGCG TGTCCGCGGGGCGCGGCGAAGTGAACTTGTTGGATACATCAACCATCCACGGAGACTGGGGCTGGCTCAC GTATCCCGCTCATGGGTGGGACTCCATCAACGAGGTAGACGAGTCCTTCCGGCCCATCCACACGTACCA .... ensembl_transcript_id coding ENSMUSG00000028661 ENSMUST00000030420 Hope this helps somebody. Cheers, Nenad Nenad Bartonicek PhD student, Enright group European Bioinformatics Institute Hinxton Cambridge CB10 1SD United Kingdom > sessionInfo() R version 2.11.0 (2010-04-22) x86_64-unknown-linux-gnu locale: [1] LC_CTYPE=en_GB.UTF-8 LC_NUMERIC=C [3] LC_TIME=en_GB.UTF-8 LC_COLLATE=en_GB.UTF-8 [5] LC_MONETARY=C LC_MESSAGES=en_GB.UTF-8 [7] LC_PAPER=en_GB.UTF-8 LC_NAME=C [9] LC_ADDRESS=C LC_TELEPHONE=C [11] LC_MEASUREMENT=en_GB.UTF-8 LC_IDENTIFICATION=C attached base packages: [1] stats graphics grDevices datasets utils methods base other attached packages: [1] BSgenome_1.16.5 seqinr_2.0-9 RMySQL_0.7-4 [4] DBI_0.2-5 RColorBrewer_1.0-2 biomaRt_2.4.0 [7] ShortRead_1.6.2 Rsamtools_1.0.5 lattice_0.18-8 [10] Biostrings_2.16.7 GenomicRanges_1.0.5 IRanges_1.6.8 [13] R.utils_1.4.3 R.oo_1.7.3 R.methodsS3_1.2.0 loaded via a namespace (and not attached): [1] Biobase_2.8.0 grid_2.11.0 hwriter_1.2 RCurl_1.4-2 tools_2.11.0 [6] XML_3.1-0 [[alternative HTML version deleted]]

Hi Nenad, Thanks for reporting this. I'll look into what is causing this. Most likely it is a bug at the Ensembl BioMart server side and not the biomaRt package. Cheers, Steffen On Thu, Jul 8, 2010 at 9:24 AM, Nenad Bartonicek <nenad@ebi.ac.uk> wrote: > Hi, > > I would like to report a bug in biomaRt service. > If I use the function getBM and I am searching for UTRs or coding > sequence as well as identifiers, I get them in scrambled order. > Meaning, the content of columns does not correspond to their headers: > > library(biomaRt) > ensembl=useMart("ensembl", dataset="mmusculus_gene_ensembl") > getBM > (attributes > = > c > ("ensembl_gene_id > ","ensembl_transcript_id > ","coding > "),filters > ="ensembl_gene_id",values=c("ENSMUSG00000028661"),mart=ensembl) > > This will result in something like: > > ensembl_gene_id > > > ATGGCCCCCGCCCGGGCCCGCCTGTCCCCCGCTCTCTGGGTCGTCACGGCCGCGGCGGCGGCCACCTG CGTGTCCGCGGGGCGCGGCGAAGTGAACTTGTTGGATACATCAACCATCCACGGAGACTGGGGCTGGCTC ACGTATCCCGCTCATGGGTGGGACTCCATCAACGAGGTAGACGAGTCCTTCCGGCCCATCCACACGTACC A > .... > > ensembl_transcript_id coding > ENSMUSG00000028661 ENSMUST00000030420 > > Hope this helps somebody. > > Cheers, > > Nenad > > Nenad Bartonicek > PhD student, Enright group > European Bioinformatics Institute > Hinxton > Cambridge > CB10 1SD > United Kingdom > > > > sessionInfo() > R version 2.11.0 (2010-04-22) > x86_64-unknown-linux-gnu > > locale: > [1] LC_CTYPE=en_GB.UTF-8 LC_NUMERIC=C > [3] LC_TIME=en_GB.UTF-8 LC_COLLATE=en_GB.UTF-8 > [5] LC_MONETARY=C LC_MESSAGES=en_GB.UTF-8 > [7] LC_PAPER=en_GB.UTF-8 LC_NAME=C > [9] LC_ADDRESS=C LC_TELEPHONE=C > [11] LC_MEASUREMENT=en_GB.UTF-8 LC_IDENTIFICATION=C > > attached base packages: > [1] stats graphics grDevices datasets utils methods base > > other attached packages: > [1] BSgenome_1.16.5 seqinr_2.0-9 RMySQL_0.7-4 > [4] DBI_0.2-5 RColorBrewer_1.0-2 biomaRt_2.4.0 > [7] ShortRead_1.6.2 Rsamtools_1.0.5 lattice_0.18-8 > [10] Biostrings_2.16.7 GenomicRanges_1.0.5 IRanges_1.6.8 > [13] R.utils_1.4.3 R.oo_1.7.3 R.methodsS3_1.2.0 > > loaded via a namespace (and not attached): > [1] Biobase_2.8.0 grid_2.11.0 hwriter_1.2 RCurl_1.4-2 tools_2.11.0 > [6] XML_3.1-0 > > > > > > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor@stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > [[alternative HTML version deleted]]