Dear all, thanks for the great input so far. I now have to test it and understand it. If there are any problems remaining, I will let you know ;-) Thanks and best whishes, Karsten > > Hi Karsten, > > if you created an AffyBatch x with ReadAffy, then exprs(x) is a matrix > whose rows correspond to the probes on the array, one after the other > as they physically on the chip. The mapping between row-index in the > AffyBatch and (x,y)-coordinates is provided by the functions > indices2xy and xy2indices in the 'affy' package (whose code you can > see by typing their name). Essentially, it is very simple: > > x = (i - 1) %% nr > y = (i - 1) %/% nr > and in reverse: > i = x + 1 + nr * y > > where nr is the width of the chip. So one strategy is to compute the > (x,y) index of each probe on your array by > > indices2xy(seq_len(nrow(mitdata)), abatch=mitdata) > > and use this to merge with your probe-sequence table. This might be > easier and more transparent than going through probeNames. > > Probe sequences for many Affymetrix chips are obtained through the > 'probe' packages (whose content is complementary to the smaller 'cdf' > packages): > > library(hgu95av2probe) > head(as.data.frame(hgu95av2probe)) > > > Best wishes > Wolfgang > > > Karsten Voigt scripsit 12/01/11 15:28: >> Hi all, >> >> On 01/11/2011 07:36 PM, James W. MacDonald wrote: >>> Hi Karsten, >>> >>> On 1/11/2011 12:56 PM, Karsten Voigt wrote: >>>> Dear all, >>>> >>>> I am currently working on a project where I need to get the exact >>>> IDs of >>>> probes of a custom Affymetrix Chip in order to merge it with another >>>> list containing the sequence. >>>> >>>> I am using this small R script for creating the list: >>>> >>>> mitdata <- ReadAffy(); >>>> stddata <- apply(pm(mitdata), 2, bg.adjust); >>>> nrmdata <- normalize.quantiles(stddata); >>>> namedata <- probeNames(mitdata); >>>> enddata <- cbind(namedata, nrmdata); >>>> write.table(enddata, file="probesdata.txt",sep="\t"); >>>> >>>> This is an output example >>>> >>>> ... >>>> 145 TZG_ARR_0001_x_at 135.115780787133 ... >>>> 146 TZG_ARR_0001_x_at 147.346049115501 ... >>>> 147 TZG_ARR_0001_x_at 203.840215898533 ... >>>> 148 TZG_ARR_0003_x_at 48.7635207480323 ... >>>> ... >>>> >>>> As you can see, a number of probes have the same name but refer to >>>> different oligos. The number in front of the row is just added by me, >>>> therefore you can ignore it. >>>> >>>> I received a list containing the probe name, a couple of other >>>> information AND the sequence. >>>> >>>> This is a part of it: >>>> >>>> 15 ggagattgtttgtaatcaaaatgaa TGZ_ARR_0001_x ! 2398 0 176 200 + 1 >>>> 103 gcaaatttacttctaacagctgatc TGZ_ARR_0001_x ! 2398 1 264 288 + 1 >>>> 188 ttgatgcaactgtaaacaaaagtgg TGZ_ARR_0001_x ! 2398 2 349 373 + 1 >>>> 15 gatagattcttcaagtaacaatact TGZ_ARR_0003_x ! 2400 0 2046 2070 + 1 >>>> >>>> This should be the same area. >>>> >>>> In this received list, I can identify the unique probes using the 2 >>>> numbers right after the exclamation mark, which are referring to the >>>> position on the chip, I guess. How can I extract those coordinates for >>>> my own list? I tried it with indices2xy, however I failed to get it >>>> running since I don't understand how to use this function correctly. >>> >>> Using the hgu95av2cdf as an example: >>> >>> > library(hgu95av2cdf) >>> > x <- as.list(hgu95av2cdf) >>> > x <- x[order(names(x))] >>> > x <- unlist(sapply(x, function(x) x[,1])) >>> > xys <- indices2xy(x, cdf="hgu95av2cdf") >>> > head(xys) >>> x y >>> 1000_at1 399 559 >>> 1000_at2 544 185 >>> 1000_at3 530 505 >>> 1000_at4 617 349 >>> 1000_at5 459 489 >>> 1000_at6 408 545 >>> >>> Best, >>> >>> Jim >>> >> >> first of all, many thanks to Jim for the quick and good answer. I runned >> your script on my own cdf and it is exactly extracting what I am looking >> for. >> >> However I still cannot identify the probes in my CEL-files loaded by the >> ReadAffy() function. If I run probeNames on it, the probes will be >> exported alphabetically. I cannot imagine that the CEL file probe values >> are also sorted alphabetically in the way I gained it. >> >> I think my way of creating this list is wrong since it is highly >> unlikely and impossible to prove that the probe names and the normalized >> data are listed in the same order: >> >> How can I prove that the probeNames are fitting to the probe values? Is >> it also possible to extract the x y values out of the cdf file? >> >> One other question: Is there any possibility to extract the sequence out >> of the cdf file? >> >> Many thanks in advance again, >> >> Karsten >> >> > > -- _________________________________________________ Karsten Voigt, Msc. Experimentelle Bioinformatik, Hess Group University of Freiburg, BIO III t: 0761-2032708 m: 0176-61110420 e: karsten.voigt at biologie.uni-freiburg.de