[Fwd: help in annotation ILLUMINA probes]
1
0
Entering edit mode
nac ▴ 280
@nac-4545
Last seen 10.2 years ago
Dear all, I have a set of probes Ids from illumina beads arrays illuminaProbeID ILMN_1250814 ILMN_1257855 ILMN_2537948 ILMN_3144164 ILMN_2636200 what is the best way to fetch the chromosomal location of those ( chr: start :end)? Many thanks Nathalie -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE.
• 1.4k views
ADD COMMENT •
0
Entering edit mode
Mete Civelek ▴ 180
@mete-civelek-4566
Last seen 10.2 years ago
Illumina has this information on their manifest files for each beadchip. -----Original Message----- From: bioconductor-bounces@r-project.org [mailto:bioconductor-bounces at r-project.org] On Behalf Of Nathalie Conte Sent: Monday, May 16, 2011 10:14 AM To: Bioconductor mailing list Subject: [BioC] [Fwd: help in annotation ILLUMINA probes] Dear all, I have a set of probes Ids from illumina beads arrays illuminaProbeID ILMN_1250814 ILMN_1257855 ILMN_2537948 ILMN_3144164 ILMN_2636200 what is the best way to fetch the chromosomal location of those ( chr: start :end)? Many thanks Nathalie -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose registered office is 215 Euston Road, London, NW1 2BE. _______________________________________________ Bioconductor mailing list Bioconductor at r-project.org https://stat.ethz.ch/mailman/listinfo/bioconductor Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor IMPORTANT WARNING: This email (and any attachments) is ...{{dropped:9}}
ADD COMMENT •
0
Entering edit mode
Hi Nathalie, You can use the illumina Bioconductor annotation packages to do this. The particular one you need is illuminaMousev2.db >library(illuminaMousev2.db) > ids = c("ILMN_1250814", "ILMN_1257855", "ILMN_2537948", "ILMN_3144164", "ILMN_2636200") > mget(ids, illuminaMousev2GENOMICLOCATION) $ILMN_1250814 [1] "chr9:53240676:53240725:+" $ILMN_1257855 [1] "chrX:96269326:96269375:+" $ILMN_2537948 [1] "chr6:68192672:68192721:+" $ILMN_3144164 [1] "chr8:11004508:11004557:-" $ILMN_2636200 [1] "chr10:5324478:5324527:+" The coordinates are based on the mm9 assembly. You can also retrieve the probe sequences themselves in a similar technique. > mget(ids, illuminaMousev2PROBESEQUENCE) $ILMN_1250814 [1] "GGATTCCCTTTTCTGAGCGATGGACCTACCTTCAAGCCCACTTTCCAGCG" $ILMN_1257855 [1] "CCTCATGCCTTTTGCCTACAGTGGTGGTCTATAAGAACAGTCCTTTTGGC" $ILMN_2537948 [1] "GGGCAAGGACCACAGCCAACTTCCTCTTACAAGCCACACCGACTTTGTCC" $ILMN_3144164 [1] "CCAGGCACTGGAGCTTTGCCCTCTGCCAGCACCTATGCAAGCATCGACTT" $ILMN_2636200 [1] "TTTGCCCGATCCTTCCATCCGATGCTCAGATATACCAACGGTCCTCCTCC" Running the following will list all available mappings in the package. > illuminaMousev2() Best wishes, Mark On Mon, May 16, 2011 at 6:44 PM, Mete Civelek <mcivelek at="" mednet.ucla.edu=""> wrote: > Illumina has this information on their manifest files for each beadchip. > > -----Original Message----- > From: bioconductor-bounces at r-project.org > [mailto:bioconductor-bounces at r-project.org] On Behalf Of Nathalie Conte > Sent: Monday, May 16, 2011 10:14 AM > To: Bioconductor mailing list > Subject: [BioC] [Fwd: help in annotation ILLUMINA probes] > > Dear all, > I have a set of probes Ids from illumina beads arrays > > illuminaProbeID > ILMN_1250814 > ILMN_1257855 > ILMN_2537948 > ILMN_3144164 > ILMN_2636200 > > > what is the best way to fetch the chromosomal location of those ( chr: > start :end)? > > Many thanks > Nathalie > > > -- > ?The Wellcome Trust Sanger Institute is operated by Genome Research > ?Limited, a charity registered in England with number 1021457 and a > ?company registered in England with number 2742969, whose registered > ?office is 215 Euston Road, London, NW1 2BE. > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor > > > IMPORTANT WARNING: ?This email (and any attachments) is ...{{dropped:9}} > > _______________________________________________ > Bioconductor mailing list > Bioconductor at r-project.org > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >
ADD REPLY •
0
Entering edit mode
On Tue, 17 May 2011 17:12:13 +0900, Mark Dunning <mark.dunning at="" gmail.com=""> wrote: > Hi Nathalie, > > You can use the illumina Bioconductor annotation packages to do this. > The particular one you need is illuminaMousev2.db > >> library(illuminaMousev2.db) > >> ids = c("ILMN_1250814", "ILMN_1257855", "ILMN_2537948", "ILMN_3144164", >> "ILMN_2636200") > >> mget(ids, illuminaMousev2GENOMICLOCATION) Dear Mark, I ran the code but came across some problems. Here's my history library("AnnotationDbi") source("http://bioconductor.org/biocLite.R") biocLite("illuminaMousev2.db") library(illuminaMousev2.db) ids = c("ILMN_1250814", "ILMN_1257855", "ILMN_2537948", "ILMN_3144164", "ILMN_2636200") mget(ids, illuminaMousev2GENOMICLOCATION) Error: object 'illuminaMousev2GENOMICLOCATION' not found Error in mget(ids, illuminaMousev2GENOMICLOCATION) : error in evaluating the argument 'envir' in selecting a method for function 'mget' sessionInfo() R version 2.11.0 (2010-04-22) x86_64-unknown-linux-gnu locale: [1] C attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] illuminaMousev2.db_1.6.1 org.Mm.eg.db_2.4.1 RSQLite_0.9-2 [4] DBI_0.2-5 AnnotationDbi_1.10.1 Biobase_2.8.0 loaded via a namespace (and not attached): [1] tools_2.11.0 Cheers, -- Dave
ADD REPLY •
0
Entering edit mode
Hi Dave, On Wed, May 25, 2011 at 11:10 PM, Dave Tang <davetingpongtang at="" gmail.com=""> wrote: > On Tue, 17 May 2011 17:12:13 +0900, Mark Dunning <mark.dunning at="" gmail.com=""> > wrote: > >> Hi Nathalie, >> >> You can use the illumina Bioconductor annotation packages to do this. >> The particular one you need is illuminaMousev2.db >> >>> library(illuminaMousev2.db) >> >>> ids = c("ILMN_1250814", "ILMN_1257855", "ILMN_2537948", "ILMN_3144164", >>> "ILMN_2636200") >> >>> mget(ids, illuminaMousev2GENOMICLOCATION) > > Dear Mark, > > I ran the code but came across some problems. Here's my history > > library("AnnotationDbi") > source("http://bioconductor.org/biocLite.R") > biocLite("illuminaMousev2.db") > library(illuminaMousev2.db) > ids = c("ILMN_1250814", "ILMN_1257855", "ILMN_2537948", "ILMN_3144164", > "ILMN_2636200") > mget(ids, illuminaMousev2GENOMICLOCATION) > > Error: object 'illuminaMousev2GENOMICLOCATION' not found > Error in mget(ids, illuminaMousev2GENOMICLOCATION) : > ?error in evaluating the argument 'envir' in selecting a method for function > 'mget' > > sessionInfo() > R version 2.11.0 (2010-04-22) > x86_64-unknown-linux-gnu As a general rule of thumb, you should be running the latest version of the R and bioconductor combo to get the most milage out of the help on this mailing list. The latest version of R is 2.13.0, which was recently released. If you use that with the appropriate bioconductor version (v 2.8 -- which is chosen automatically for you when installing via biocLite()) the code works as advertised. -steve -- Steve Lianoglou Graduate Student: Computational Systems Biology ?| Memorial Sloan-Kettering Cancer Center ?| Weill Medical College of Cornell University Contact Info: http://cbio.mskcc.org/~lianos/contact
ADD REPLY •
0
Entering edit mode
On Thu, 26 May 2011 12:30:33 +0900, Steve Lianoglou <mailinglist.honeypot at="" gmail.com=""> wrote: > As a general rule of thumb, you should be running the latest version > of the R and bioconductor combo to get the most milage out of the help > on this mailing list. > The latest version of R is 2.13.0, which was recently released. If you > use that with the appropriate bioconductor version (v 2.8 -- which is > chosen automatically for you when installing via biocLite()) the code > works as advertised. Hi Steve, Thank you for the reply and the kind note. I will make sure I'm up to date in the future. Cheers, -- Dave
ADD REPLY •

Login before adding your answer.

Similar Posts
Loading Similar Posts
Traffic: 753 users visited in the last hour
Content Search
Users
Tags
Badges
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6