Thanks Valerie, Your explanation was much better than the one I found in the ?pairwiseAlignment man page. It states: "global" = align whole strings with end gap penalties ... "global- local" = align whole strings in pattern with consecutive subsequence of subject Obviously the "whole strings" were not aligned in my previous email's examples. A quick workaround for this issue that does not require changing the default gap penalties is to pad the subject sequences with multiple gaps on both ends. pairwiseAlignment("ACTGACTGACTGACTG","-- CTGAGAGGGTGATCGGCCACATTGGG--",type="global-local") Global-Local PairwiseAlignedFixedSubject (1 of 1) pattern: [1] ACTGACTGACTGACTG subject: [2] -CTGAGAGGGTGATCG score: -21.21098 Thanks again, Erik On Feb 20, 2012, at 11:53 PM, Valerie Obenchain wrote: > Hi Erik, > > This behavior can be explained by altering the gapOpening and > gapExtension arguments. You may want to look up "affine gap penalty" and > look at paper referenced on the ?pairwiseAlignment man page. > > By default gapOpening=-10 and gapExtension=-2. Using the defaults we > match your example below, > > pairwiseAlignment("ACTGACTGACTGACTG", "AAGAAGAGTTATGGGAGTAACTGACC", > gapOpening=-10, gapExtension=-2) > > If we don't penalize the presence or extension of gaps we get an > alignment that includes enough gaps to match the sequences. It is not > recommended to not penalize gaps, this is for the sake of example. > > pairwiseAlignment("ACTGACTGACTGACTG", "AAGAAGAGTTATGGGAGTAACTGACC", > gapOpening=0, gapExtension=0) > > > The same can be done with your global-local example to get an idea of > how these parameters affect the outcome. Additionally, global-local > tries to find an alignment that matches the start and the end of one or > the other sequence. This is useful for the case where one sequence is > downstream of the other and they partially overlap. The global algorithm > tries to align every residue in each sequence. You'll want to choose the > algorithm that is most appropriate for your data then modify the > arguments if necessary. > > > Valerie > > > > On 02/15/2012 02:25 PM, Erik Wright wrote: >> Hello, >> >> I have been using the Biostrings function "pairwiseAlignment" lately to perform sequence alignments. I have discovered that with difficult alignments it sometimes returns incomplete patterns. For example: >> >> pairwiseAlignment("ACTGACTGACTGACTG","AAGAAGAGTTATGGGAGTAACTGACC") >> Global PairwiseAlignedFixedSubject (1 of 1) >> pattern: [1] ACT-----------GACTGACTGACT >> subject: [1] AAGAAGAGTTATGGGAGTAACTGACC >> score: -77.67886 >> >> As you can see, the last character of the pattern ("G") has been removed. If I set type="global-local" this does not happen, but it does in this instance: >> >> pairwiseAlignment("ACTGACTGACTGACTG","CTGAGAGGGTGATCGGCCACATTGGG",type ="global-local") >> Global-Local PairwiseAlignedFixedSubject (1 of 1) >> pattern: [2] CTGACTGACTGACTG >> subject: [1] CTGAGAGGGTGATCG >> score: -31.55991 >> >> In this case the first character of the pattern ("A") was removed in the alignment. >> >> Please help me to understand why this is happening, and if there might be a solution. >> >> Thanks in advance, >> Erik >> >> >> sessionInfo() >> R version 2.14.0 (2011-10-31) >> Platform: x86_64-apple-darwin9.8.0/x86_64 (64-bit) >> >> locale: >> [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8 >> >> attached base packages: >> [1] stats graphics grDevices utils datasets methods base >> >> other attached packages: >> [1] RSQLite_0.10.0 DBI_0.2-5 Biostrings_2.22.0 IRanges_1.12.2 >> >> loaded via a namespace (and not attached): >> [1] tools_2.14.0 >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor@r-project.org >> https://stat.ethz.ch/mailman/listinfo/bioconductor >> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor >> > [[alternative HTML version deleted]]