Hai, The output file generated from the R+Bioconductor ( using Limma package) shows some column headers as: *A* *Coef.group1* *Coef.group2* *t.group1* *t.group2* * p.value.group1* *p.value.group2* *F* *F.p.value* *Genes.Row* *Genes.Col* * Genes.Start* Genes.Sequence Genes.ProbeUID Genes.ControlType Genes.ProbeName Genes.GeneName Genes.SystematicName Genes.Description 17.05 17.004 17.093 7.33318E+15 7.37131E+15 0 0 5.41E+31 0 1 1 0 0 1 GE_BrightCorner GE_BrightCorner GE_BrightCorner 5.07 5.045 5.099 8.7028E+15 8.79586E+15 0 0 7.66E+31 0 1 2 0 1 1 DarkCorner DarkCorner DarkCorner 7.89 7.831 7.951 1.35074E+16 1.37155E+16 0 0 1.85E+32 0 1 4 0 GGAGTATGTTCATTCTTGGCTCTCCATCCTCTTCTGTCTTGCATATTTGGTAGCATTTAT 3 0 GT_HS_44k_0494 OR51L1 NM_001004755 olfactory receptor, family 51, subfamily L, member 1 What does those column headers which are high lightened in red color,obtained in the output indicate?? The R *sessionInfo*() shows like: R version 2.15.0 (2012-03-30) Platform: x86_64-pc-mingw32/x64 (64-bit) locale: [1] LC_COLLATE=English_India.1252 LC_CTYPE=English_India.1252 LC_MONETARY=English_India.1252 LC_NUMERIC=C LC_TIME=English_India.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] limma_3.10.3 Muralidharan V [[alternative HTML version deleted]]