Search
Question: GRanges Constructor With seqlengths
0
gravatar for Dario Strbenac
5.5 years ago by
Dario Strbenac1.4k
Australia
Dario Strbenac1.4k wrote:
Hi, I'm having problems using the seqlengths parameter. Suggestions ? > head(x) chr position 1 chr12 13352230 2 chr11 66387388 3 chr16 54958470 4 chr16 54901876 5 chr11 66386240 6 chr16 54925044 sequence 1 CAGAGACCAGATTAGGCCCATCAAGTTCCCAGCCTTGTCAGTGGGCTTCA 2 AGATAGGAGAACTTGTTTTTCTGGATTCACTTAACTTTGTTACTGGAGGACTTG 3 TCTTTCTCATAGCTTTTCTTACCTGCCTATATTCAGCAGCCTCTATTTGATGAGAAATGACAAG 4 AGTATTAAACAAGAATGCACGTAAAGTGTGCAATGCATATAGCAGACAGTCAAGAAATGGTGT 5 CAAACATCTGAAGGGACAGTCTCCCTGGAACTCAGGCTTCTTGCTGGCTT 6 AGGAAAGTTTCCCAGGTTTCATTACATGTTTTCACGATTTAGCTTAAATGTT > seqlengths(Hsapiens)[unique(x$chr)] chr4 chr3 chr7 chr8 chr15 chr18 chr10 chr5 191154276 198022430 159138663 146364022 102531392 78077248 135534747 180915260 chr17 chr11 chr2 chr20 chr21 chr6 chr19 chrX 81195210 135006516 243199373 63025520 48129895 171115067 59128983 155270560 chr22 chr1 chr16 chr12 chr9 chr14 chr13 51304566 249250621 90354753 133851895 141213431 107349540 115169878 > GRanges(x$chr, IRanges(x$position, width=1), seqlengths=seqlengths(Hsapiens)[unique(x$chr)]) Error in validObject(.Object) : invalid class ?GRanges?object: 'seqnames' contains missing values > GRanges(x$chr, IRanges(x$position, width=1)) GRanges with 59335 ranges and 0 elementMetadata cols: seqnames ranges strand <rle> <iranges> <rle> [1] chr12 [13352230, 13352230] * [2] chr11 [66387388, 66387388] * [3] chr16 [54958470, 54958470] * [4] chr16 [54901876, 54901876] * [5] chr11 [66386240, 66386240] * [6] chr16 [54925044, 54925044] * [7] chr12 [88888128, 88888128] * [8] chr11 [ 1075886, 1075886] * [9] chr16 [54893488, 54893488] * ... ... ... ... [59327] chr8 [ 82392570, 82392570] * [59328] chr3 [195474810, 195474810] * [59329] chr1 [ 77335014, 77335014] * [59330] chr4 [141674200, 141674200] * [59331] chr5 [176021996, 176021996] * [59332] chr16 [ 54931950, 54931950] * [59333] chr16 [ 54960706, 54960706] * [59334] chr5 [150321696, 150321696] * [59335] chr19 [ 33791323, 33791323] * --- seqlengths: chr1 chr10 chr11 chr12 chr14 chr15 ... chr6 chr7 chr8 chr9 chrX chrY NA NA NA NA NA NA ... NA NA NA NA NA NA > sessionInfo() R version 2.15.0 (2012-03-30) Platform: x86_64-unknown-linux-gnu (64-bit) locale: [1] LC_CTYPE=en_AU.UTF-8 LC_NUMERIC=C [3] LC_TIME=en_AU.UTF-8 LC_COLLATE=en_AU.UTF-8 [5] LC_MONETARY=en_AU.UTF-8 LC_MESSAGES=en_AU.UTF-8 [7] LC_PAPER=C LC_NAME=C [9] LC_ADDRESS=C LC_TELEPHONE=C [11] LC_MEASUREMENT=en_AU.UTF-8 LC_IDENTIFICATION=C attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] BSgenome.Hsapiens.UCSC.hg19_1.3.17 BSgenome_1.24.0 [3] Biostrings_2.24.1 GenomicRanges_1.8.6 [5] IRanges_1.14.2 BiocGenerics_0.2.0 loaded via a namespace (and not attached): [1] stats4_2.15.0
ADD COMMENTlink modified 5.5 years ago • written 5.5 years ago by Dario Strbenac1.4k
0
gravatar for Dario Strbenac
5.5 years ago by
Dario Strbenac1.4k
Australia
Dario Strbenac1.4k wrote:
It works if the chr column is converted to character type first. It was a factor.
ADD COMMENTlink written 5.5 years ago by Dario Strbenac1.4k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 258 users visited in the last hour