OTU delimitation from simple fasta (sanger) sequences
0
0
Entering edit mode
@martin-unterseher-5453
Last seen 6.8 years ago
Dear all, I struggled with readOTUset{OTUbase} for some time, searched the web and r-archives including this one without success. Whereas OTUbase is obviously designed for NGS datasets after passing specific 454 pipelines, I am searching a convenient method to delimit OTUs from a simple (sanger) sequence fasta file such as this one (fungal ITS sequences), with the possibility to specify e.g. sequence similarity of 97% over at least 90% length. The fasta header >VASmic02 says "sequence 02 from host plant VASmic. This example file consists of 10 sequences from 3 host plants VASmic, TILusn and HEVbra. >VASmic02 ACCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGG CTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTACACCA CTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGT CCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTC TAAGG >VASmic05 CCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGTGGGTTCGCCCGCCGATCGGACAACATTCAA ACCCTTTGCAGTTGCAATCAGCGTCTGAAAAAACATAATAGTTAGTACCTTCAAGCTCTGCTTGGTGTTG GGTGTTTGTCTCGCCTCTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGC GCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAGTACATTTTTAACTC >VASmic06_1 TACCATCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAAAC TTAAACCCTTTGTAATTGAAATCAGCGTCTGAAAAAACATAATAGTTAGTACCTTCAAGCTCTGCTTGGT GTTGGGTGTTTGTCTCGCCTTTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCG GAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAAGTACTTTTTACACTC >TILusn11 TGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAAACTTAAACCCTTTGTAAT TGAAATCAGCGTCTGAAAAAACATAATAGTTAGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCTC GCCTTTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTC GCGCTTTGCACTCATAACGACGACGTCCAAAAAGTACTTTTTACACTC >TILusn12 GTATTATTACTTTGTTGCTTTGGCGAGCTGCCTTCGGGCCTTGTATGCTCGCCAGAGAATACCAAAACTC TTTTTATTAATGTCGTCTGAGTACTATATAATAGTTACAACCCTCAAGCTTAGCTTGGTATTGAGTCTAT GTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTA CAGGTTCTCGGTGTGCTTCTGCCAAAACCCAAATTTTTCTATGG >VASmic14 ATCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAAACTTAA ACCCTTTGTAATTGAAATCAGCGTCTGAAAAAACATAATAGTTAGTACCTTCAAGCTCTGCTTGGTGTTG GGTGTTTGTCTCGCCTTTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGC GCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAAGTACTTTTTACACTC >VASmic16 CTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGGTTGGACAACATTCAAA CCCTTTGCAGTTGCAATCAGCGTCTGAAAAAACTTAATAGTTAGTACCTTCAAGCTCTGCTTGGTGTTGG GTGTTTTGTCTCGCCTCCGCGCGCAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAGC GCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAGTACATTTTTACACTC >HEVbra17 ACCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAACATTCA AACCCTTTGCAGTTGCAATCAGCGTCTGAAAAAACATAATAGTTAGTACCTTCAAGCTCTGCTTGGTGTT GGGTGTTTGTCTCTCCTCTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTCGGAG CGCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAGTACATTTTTACACTC >HEVbra18 CTACCATCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAAA CTTAAACCCTTTGTAATTGAAATCAGCGTCTGAAAAAACATAATAGTTAGTACCTTCAAGCTCTGCTTGG TGTTGGGTGTTTGTCTCGCCTTTGCGTGTAGACTCGCCTTAAAACAATTGGCAGCCGGCGTATTGATTTC GGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACGACGTCCAAAAAGTACTTTTTACACTC >VASmic21 ACCTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGC CGGAGGGACCAACCAAACTCTTTCTGTAATCCCCTCGCGGACGTTATTTTTACAGCTCTGAGCAAAAATT CAAAATGAATCACAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGA TCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACC GGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG There are surely several reasonable possibilities for an output, among others maybe this one (e.g. as data frame), which would allow subsequent diversity analyses with vegan, e.g. specaccum, metaMDS, etc. VASmic TILusn HEVbra OTU.01 4 1 1 OTU.02 2 1 0 OTU.03 0 0 1 Hoping that someone can help me with this. Best Martin __________ PD Dr. Martin Unterseher Universit?t Greifswald Institut f?r Botanik und Landschafts?kologie Grimmer Str. 88 17487 Greifswald Tel. 03834 / 864184 Fax. 03834 / 864114 http://www.botanik.uni-greifswald.de/100.html
OTUbase OTUbase • 495 views
ADD COMMENT

Login before adding your answer.

Traffic: 404 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6