Entering edit mode
Seyed Ahmad Mousavi
▴
10
@seyed-ahmad-mousavi-5466
Last seen 9.6 years ago
>
>
> Hello
>
> I'm very eager to use Limma package for analyzing my Illumina
microarray
> data,
> but i faced with problem in contrast matrix,i have 12 sample with
below
> names in four group as you see:
>
> MR-VI-R1, MR-VI-R2, MR-VI-R3,
> MR-IX-R1, MR-IX-R2, MR-IX-R3,
> MR-XII-R1, MR-XII-R2, MR-XII-R3
> MR-XV-R1, MR-XV-R2, MR-XV-R3
>
> and i want to cluster them into four group named :
> "Six","Nine","Twelve","**Fifteen". But because of Illumina raw file
i
> could
> not use
> targets<- readTarget()
> and another error on model.matrix().
>
> Therefore, How can i create contrast matrix?
> And you can find ten rows of my file in attachment.
>
> I appreciated for your reply.
> bests,
>
>
>
> --
Seyed Ahmad Mousavi
-------------- next part --------------
PROBE_ID SYMBOL MR-VI-R1.AVG_Signal MR-VI-R1.Detection
Pval MR-VI-R1.BEAD_STDERR MR-VI-R1.Avg_NBEADS MR-
VI-R2.AVG_Signal MR-VI-R2.Detection Pval MR-VI-R2.BEAD_STDERR
MR-VI-R2.Avg_NBEADS MR-VI-R3.AVG_Signal MR-VI-R3.Detection
Pval MR-VI-R3.BEAD_STDERR MR-VI-R3.Avg_NBEADS MR-
IX-R1.AVG_Signal MR-IX-R1.Detection Pval MR-IX-R1.BEAD_STDERR
MR-IX-R1.Avg_NBEADS MR-IX-R2.AVG_Signal MR-IX-R2.Detection
Pval MR-IX-R2.BEAD_STDERR MR-IX-R2.Avg_NBEADS MR-
IX-R3.AVG_Signal MR-IX-R3.Detection Pval MR-IX-R3.BEAD_STDERR
MR-IX-R3.Avg_NBEADS MR-XII-R1.AVG_Signal MR-XII-R1.Detection
Pval MR-XII-R1.BEAD_STDERR MR-XII-R1.Avg_NBEADS MR-
XII-R2.AVG_Signal MR-XII-R2.Detection Pval MR-
XII-R2.BEAD_STDERR MR-XII-R2.Avg_NBEADS MR-XII-R3.AVG_Signal
MR-XII-R3.Detection Pval MR-XII-R3.BEAD_STDERR MR-
XII-R3.Avg_NBEADS MR-XV-R1.AVG_Signal MR-XV-R1.Detection Pval
MR-XV-R1.BEAD_STDERR MR-XV-R1.Avg_NBEADS MR-XV-R2.AVG_Signal
MR-XV-R2.Detection Pval MR-XV-R2.BEAD_STDERR MR-XV-R2.Avg_NBEADS
MR-XV-R3.AVG_Signal MR-XV-R3.Detection Pval MR-XV-R3.BEAD_STDERR
MR-XV-R3.Avg_NBEADS SEARCH_KEY ILMN_GENE CHROMOSOME
DEFINITION SYNONYMS TargetID ProbeID SPECIES SOURCE
TRANSCRIPT SOURCE_REFERENCE_ID REFSEQ_ID UNIGENE_ID
ENTREZ_GENE_ID GI ACCESSION PROTEIN_PRODUCT
ARRAY_ADDRESS_ID PROBE_TYPE PROBE_START PROBE_SEQUENCE
PROBE_CHR_ORIENTATION PROBE_COORDINATES CYTOBAND
ONTOLOGY_COMPONENT ONTOLOGY_PROCESS ONTOLOGY_FUNCTION
OBSOLETE_PROBE_ID
ILMN_1762337 7A5 68.12339 0.5909091 3.795977
22 81.03699 0.187013 6.871885 25
84.15965 0.2363636 5.430288 23 84.16862
0.312987 5.658892 21 85.88108 0.2701299
4.357348 24 86.96101 0.2012987 5.839043
19 86.12077 0.2818182 5.816843 19
87.9188 0.2519481 4.042889 28 81.01576
0.448052 4.123793 30 76.6422 0.5493507
3.354405 24 92.51734 0.151948 6.498237
22 89.08936 0.2064935 6.55511 19 NM_182762.2
7A5 7 "Homo sapiens putative binding protein 7a5 (7A5),
mRNA." 7A5 6450255 Homo sapiens RefSeq
ILMN_183371 NM_182762.2 NM_182762.2 346389
47271497 NM_182762.2 NP_877439.2 6450255 S 2725
GTGTTACAAGACCTTCAGTCAGCTTTGGACAGAATGAAAAACCCTGTGAC -
20147187-20147236 7p15.3e
ILMN_2055271 A1BG 109.9177 0.009090909 7.478013
29 91.11002 0.04805195 5.753882 22
106.9506 0.01168831 8.875629 13 105.8267
0.02857143 5.745769 27 129.1355 0 13.663
17 102.8462 0.02857143 7.67631 19 107.4112
0.01298701 6.032412 18 111.0584 0.01428571
5.395066 29 97.32375 0.08181818 5.351633
29 107.2164 0.01038961 6.678312 25
140.1994 0 18.09667 13 111.5074
0.01558442 8.496122 27 NM_130786.2 A1BG 19
"Homo sapiens alpha-1-B glycoprotein (A1BG), mRNA." A1B; GAB;
HYST2477; ABG; DKFZp686F0970 A1BG 2570615 Homo sapiens RefSeq
ILMN_175569 NM_130786.2 NM_130786.2 1
21071029 NM_130786.2 NP_570602.2 2570615 S 3151
GGGATTACAGGGGTGAGCCACCACGCCCAGCCCCAGCTTAGTTTTTTAAA -
63548541-63548590 19q13.43c The space external to the
outermost structure of a cell. For cells without external protective
or external encapsulating structures this refers to space outside of
the plasma membrane. This term covers the host cell environment
outside an intracellular parasite [goid 5576] [pmid 3458201] [evidence
IDA] "Any process specifically pertinent to the functioning of
integrated living units: cells, tissues, organs, and organisms. A
process is a collection of molecular events with a defined beginning
and end [goid 8150] [evidence ND ]" "Elemental activities, such as
catalysis or binding, describing the actions of a gene product at the
molecular level. A given gene product may exhibit one or more
molecular functions [goid 3674] [evidence ND ]" A1B; GAB;
HYST2477; ABG; DKFZp686F0970
ILMN_1736007 A1BG 77.10277 0.2844156 4.946341
29 77.45616 0.2766234 5.402149 24
87.31492 0.1532468 4.586613 17 93.6731
0.1142857 7.38156 21 94.46102 0.1 4.092672
34 91.49857 0.125974 6.968928 26
93.10905 0.1246753 6.764782 19 87.26788
0.2636364 3.600378 18 103.0366 0.04285714
7.573762 24 78.27501 0.4922078 3.718789
18 97.10295 0.1025974 6.880208 26
91.07079 0.1688312 4.898323 30 NM_130786.2
A1BG 19 "Homo sapiens alpha-1-B glycoprotein (A1BG), mRNA."
A1B; GAB; HYST2477; ABG; DKFZp686F0970 A1BG 6370619 Homo sapiens
RefSeq ILMN_18893 NM_130786.2 NM_130786.2 1
21071029 NM_130786.2 NP_570602.2 6370619 S 2512
GCAGAGCTGGACGCTGTGGAAATGGCTGGATTCCTCTGTGTTCTTTCCCA -
63549180-63549229 19q13.43c The space external to the
outermost structure of a cell. For cells without external protective
or external encapsulating structures this refers to space outside of
the plasma membrane. This term covers the host cell environment
outside an intracellular parasite [goid 5576] [pmid 3458201] [evidence
IDA] "Any process specifically pertinent to the functioning of
integrated living units: cells, tissues, organs, and organisms. A
process is a collection of molecular events with a defined beginning
and end [goid 8150] [evidence ND ]" "Elemental activities, such as
catalysis or binding, describing the actions of a gene product at the
molecular level. A given gene product may exhibit one or more
molecular functions [goid 3674] [evidence ND ]" A1B; GAB;
HYST2477; ABG; DKFZp686F0970
ILMN_2383229 A1CF 52.90083 0.9753247 3.545432
20 67.81781 0.6324675 4.712298 30
77.33617 0.474026 4.467803 24 86.87768
0.238961 6.220565 23 72.08341 0.7402598
2.987666 18 83.2159 0.312987 5.584767 27
68.96771 0.848052 4.886689 19 86.88812
0.2753247 5.355885 25 80.70195 0.4584416
4.922028 21 72.6222 0.7051948 3.763146 27
80.76499 0.4649351 5.262026 30 66.52165
0.8935065 4.160127 30 NM_138932.1 A1CF 10
"Homo sapiens APOBEC1 complementation factor (A1CF), transcript
variant 2, mRNA." ASP; MGC163391; APOBEC1CF; ACF65; ACF64; ACF;
RP11-564C4.2 A1CF 2600039 Homo sapiens RefSeq ILMN_18532
NM_138932.1 NM_138932.1 29974 20357574
NM_138932.1 NP_620310.1 2600039 A 1826
TGCTGTCCCTAATGCAACTGCACCCGTGTCTGCAGCCCAGCTCAAGCAAG -
52566586-52566635 10q11.23c "A membrane-bounded organelle
of eukaryotic cells in which chromosomes are housed and replicated. In
most cells, the nucleus contains all of the cell's chromosomes except
the organellar chromosomes, and is the site of RNA synthesis and
processing. In some species, or in specialized cell types, RNA
metabolism or DNA replication may be absent [goid 5634] [evidence
IEA]; All of the contents of a cell excluding the plasma membrane and
nucleus, but including other subcellular structures [goid 5737] [pmid
12881431] [evidence IDA]; The irregular network of unit membranes,
visible only by electron microscopy, that occurs in the cytoplasm of
many eukaryotic cells. The membranes form a complex meshwork of
tubular channels, which are often expanded into slitlike cavities
called cisternae. The ER takes two forms, rough (or granular), with
ribosomes adhering to the outer surface, and smooth (with no ribosomes
attached) [goid 5783] [evidence IEA]; Protein complex that mediates
editing of the mRNA encoding apolipoprotein B; catalyzes the
deamination of C to U (residue 6666 in the human mRNA). Contains a
catalytic subunit, APOBEC-1, and other proteins (e.g. human ASP; rat
ASP and KSRP) [goid 30895] [pmid 10781591] [evidence IDA]" Any
process involved in the conversion of a primary mRNA transcript into
one or more mature mRNA(s) prior to translation into polypeptide [goid
6397] [evidence IEA]; Any process involved in maintaining the
structure and integrity of a protein and preventing it from
degradation or aggregation [goid 50821] [pmid 12881431] [evidence IDA]
"Interacting selectively with a nucleotide, any compound consisting of
a nucleoside that is esterified with (ortho)phosphate or an
oligophosphate at any hydroxyl group on the ribose or deoxyribose
moiety [goid 166] [evidence IEA]; Interacting selectively with double-
stranded RNA [goid 3725] [pmid 11871661] [evidence IDA]; Interacting
selectively with single-stranded RNA [goid 3727] [pmid 11871661]
[evidence IDA]; Interacting selectively with any protein or protein
complex (a complex of two or more proteins that may include other
nonprotein molecules) [goid 5515] [pmid 12896982] [evidence IPI];
Interacting selectively with any protein or protein complex (a complex
of two or more proteins that may include other nonprotein molecules)
[goid 5515] [pmid 10669759] [evidence IPI]" ASP; APOBEC1CF;
ACF65; ACF64; RP11-564C4.2; MGC163391; ACF
ILMN_1806310 A1CF 72.56313 0.4025974 5.41346 22
73.24579 0.4077922 4.136171 19 88.98305
0.1298701 6.685389 17 98.15165 0.06623377
5.847287 17 80.35466 0.438961 6.995658
18 73.87639 0.6207792 3.638785 17
81.47204 0.4649351 4.067728 19 81.73926
0.4688312 3.518761 26 91.04832 0.1688312
5.863498 23 95.52895 0.07142857 7.185225
15 99.9645 0.06493507 8.038911 21 89.31906
0.2025974 4.573234 30 NM_138933.1 A1CF 10
"Homo sapiens APOBEC1 complementation factor (A1CF), transcript
variant 1, mRNA." ASP; APOBEC1CF; ACF65; ACF64; RP11-564C4.2;
MGC163391; ACF A1CF 2650615 Homo sapiens RefSeq ILMN_7300
NM_014576.2 NM_014576.2 29974 20357571
NM_014576.2 NP_055391.2 2650615 A 1893
GAGGTCTACCCAACTTTTGCAGTGACTGCCCGAGGGGATGGATATGGCAC -
52566495-52566544 10q11.23c "A membrane-bounded organelle
of eukaryotic cells in which chromosomes are housed and replicated. In
most cells, the nucleus contains all of the cell's chromosomes except
the organellar chromosomes, and is the site of RNA synthesis and
processing. In some species, or in specialized cell types, RNA
metabolism or DNA replication may be absent [goid 5634] [evidence
IEA]; All of the contents of a cell excluding the plasma membrane and
nucleus, but including other subcellular structures [goid 5737] [pmid
12881431] [evidence IDA]; The irregular network of unit membranes,
visible only by electron microscopy, that occurs in the cytoplasm of
many eukaryotic cells. The membranes form a complex meshwork of
tubular channels, which are often expanded into slitlike cavities
called cisternae. The ER takes two forms, rough (or granular), with
ribosomes adhering to the outer surface, and smooth (with no ribosomes
attached) [goid 5783] [evidence IEA]; Protein complex that mediates
editing of the mRNA encoding apolipoprotein B; catalyzes the
deamination of C to U (residue 6666 in the human mRNA). Contains a
catalytic subunit, APOBEC-1, and other proteins (e.g. human ASP; rat
ASP and KSRP) [goid 30895] [pmid 10781591] [evidence IDA]" Any
process involved in the conversion of a primary mRNA transcript into
one or more mature mRNA(s) prior to translation into polypeptide [goid
6397] [evidence IEA]; Any process involved in maintaining the
structure and integrity of a protein and preventing it from
degradation or aggregation [goid 50821] [pmid 12881431] [evidence IDA]
"Interacting selectively with a nucleotide, any compound consisting of
a nucleoside that is esterified with (ortho)phosphate or an
oligophosphate at any hydroxyl group on the ribose or deoxyribose
moiety [goid 166] [evidence IEA]; Interacting selectively with double-
stranded RNA [goid 3725] [pmid 11871661] [evidence IDA]; Interacting
selectively with single-stranded RNA [goid 3727] [pmid 11871661]
[evidence IDA]; Interacting selectively with any protein or protein
complex (a complex of two or more proteins that may include other
nonprotein molecules) [goid 5515] [pmid 12896982] [evidence IPI];
Interacting selectively with any protein or protein complex (a complex
of two or more proteins that may include other nonprotein molecules)
[goid 5515] [pmid 10669759] [evidence IPI]" ASP; APOBEC1CF;
ACF65; ACF64; RP11-564C4.2; MGC163391; ACF
ILMN_1779670 A1CF 70.65253 0.4701299 3.550031
25 71.82597 0.4662338 4.207925 21
69.21152 0.7350649 3.501202 33 82.75872
0.3597403 7.065182 16 82.12652 0.3727273
4.536701 20 67.91729 0.8168831 3.755788
21 73.68665 0.725974 3.920706 14
75.78661 0.6818182 3.96501 23 80.98547
0.4493507 5.416678 23 73.09767 0.6883117
4.225072 18 90.81487 0.1831169 7.04958 27
85.95528 0.2948052 6.538131 16 NM_138933.1
A1CF 10 "Homo sapiens APOBEC1 complementation factor (A1CF),
transcript variant 3, mRNA." ASP; ACF65; ACF64; RP11-564C4.2;
MGC163391 A1CF 5340672 Homo sapiens RefSeq ILMN_165661
NM_138933.1 NM_138933.1 29974 20357577
NM_138933.1 NP_620311.1 5340672 I 278
GGCACATGCCCAGAGCCAGAAGCGAGCATGAGCACAGCAATTCCTGGCCT -
52610479-52610528 10q11.23c "A membrane-bounded organelle
of eukaryotic cells in which chromosomes are housed and replicated. In
most cells, the nucleus contains all of the cell's chromosomes except
the organellar chromosomes, and is the site of RNA synthesis and
processing. In some species, or in specialized cell types, RNA
metabolism or DNA replication may be absent [goid 5634] [evidence
IEA]; All of the contents of a cell excluding the plasma membrane and
nucleus, but including other subcellular structures [goid 5737] [pmid
12881431] [evidence IDA]; The irregular network of unit membranes,
visible only by electron microscopy, that occurs in the cytoplasm of
many eukaryotic cells. The membranes form a complex meshwork of
tubular channels, which are often expanded into slitlike cavities
called cisternae. The ER takes two forms, rough (or granular), with
ribosomes adhering to the outer surface, and smooth (with no ribosomes
attached) [goid 5783] [evidence IEA]; Protein complex that mediates
editing of the mRNA encoding apolipoprotein B; catalyzes the
deamination of C to U (residue 6666 in the human mRNA). Contains a
catalytic subunit, APOBEC-1, and other proteins (e.g. human ASP; rat
ASP and KSRP) [goid 30895] [pmid 10781591] [evidence IDA]" Any
process involved in the conversion of a primary mRNA transcript into
one or more mature mRNA(s) prior to translation into polypeptide [goid
6397] [evidence IEA]; Any process involved in maintaining the
structure and integrity of a protein and preventing it from
degradation or aggregation [goid 50821] [pmid 12881431] [evidence IDA]
"Interacting selectively with a nucleotide, any compound consisting of
a nucleoside that is esterified with (ortho)phosphate or an
oligophosphate at any hydroxyl group on the ribose or deoxyribose
moiety [goid 166] [evidence IEA]; Interacting selectively with double-
stranded RNA [goid 3725] [pmid 11871661] [evidence IDA]; Interacting
selectively with single-stranded RNA [goid 3727] [pmid 11871661]
[evidence IDA]; Interacting selectively with any protein or protein
complex (a complex of two or more proteins that may include other
nonprotein molecules) [goid 5515] [pmid 12896982] [evidence IPI];
Interacting selectively with any protein or protein complex (a complex
of two or more proteins that may include other nonprotein molecules)
[goid 5515] [pmid 10669759] [evidence IPI]" ASP; APOBEC1CF;
ACF65; ACF64; RP11-564C4.2; MGC163391; ACF
ILMN_1653355 A26C3 80.92675 0.1883117 8.109783
14 87.24876 0.07532468 6.811801 17
88.34422 0.138961 3.450279 14 95.0621
0.0987013 5.099861 26 99.67205 0.04805195
4.906904 19 86.96521 0.2012987 3.705514
23 89.49654 0.1831169 4.219081 18
101.5247 0.03896104 6.524839 27 112.0057
0.01298701 5.793777 21 110.3927 0.003896104
8.020485 18 103.9234 0.03636364 5.481992
20 94.64548 0.1 7.94016 19 NM_001005356.1 A26C3
22 "Homo sapiens ANKRD26-like family C, member 3 (A26C3), mRNA."
ACTBL1; POTE22 A26C3 2000519 Homo sapiens RefSeq ILMN_21001
NM_001004053.2 NM_001004053.2 23784 126090670
NM_001004053.2 NP_001004053.2 2000519 A 687
CTGCTCTACATCTGGCCTCTGCCAATGGAAATTCAGAAGTAGTAAAACTC -
14662540-14662589 22q11.1c
POTE-14; ACTBL1; POTE22; POTE14
ILMN_1717783 A26C3 50.63603 0.9922078 3.991824
23 55.0159 0.951948 3.655843 29 60.36258
0.9350649 2.940427 14 55.14183 0.9896104
3.57995 17 58.29805 0.9727273 3.430729 20
53.85002 0.9948052 3.804089 13 57.16838
0.9883117 2.327278 26 57.7401 0.987013
3.939641 26 58.99149 0.9727273 3.337898
28 60.48242 0.9506493 4.02132 29 55.67406
0.9909091 3.272732 23 63.65988 0.9337662
3.662761 23 NM_001004053.1 A26C3 22 "Homo sapiens
ANKRD26-like family C, member 3 (A26C3), mRNA." ACTBL1; POTE22
A26C3 3870044 Homo sapiens RefSeq ILMN_21001 NM_001004053.2
NM_001004053.2 23784 126090670 NM_001004053.2
NP_001004053.2 3870044 S 1957
GTCATGCTAAGACTGGAACTAGACATAATGAAACATCAGAGCCAGCTAAG -
14636561-14636610 22q11.1c POTE22
ILMN_1705025 A26C3 68.09356 0.5909091 5.050897
21 72.42866 0.438961 5.45204 24 69.48825
0.7233766 3.857865 16 88.22652 0.2025974
5.069571 20 82.83955 0.3545454 7.663315
13 80.44049 0.3922078 5.01264 17 80.0291
0.5103896 6.038512 16 81.21796 0.4805195
5.193065 18 87.51312 0.238961 5.828823
21 79.4101 0.4545455 6.647317 11 96.59934
0.1051948 8.200867 23 78.44255 0.5428572
4.491963 28 XM_942354.1 A26C3 22 "Homo sapiens
ANKRD26-like family C, member 3 (A26C3), mRNA." ACTBL1; POTE22
A26C3 7050209 Homo sapiens RefSeq ILMN_21001 NM_001004053.2
NM_001004053.2 23784 126090670 NM_001004053.2
NP_001004053.2 7050209 A 701
GCCTCTGCCAATGGAAATTCAGAAGTAGTAAAACTCCTGCTGGACAGACG -
14662526-14662575 22q11.1c