Entering edit mode
                    wang peter
        
    
        ★
    
    2.0k
        @wang-peter-4647
        Last seen 11.2 years ago
        
    i want to know how this function works?
for example:
trimLRPatterns(Rpattern = Rpattern, subject = subject,
max.Rmismatch=1,with.Lindels=TRUE)
subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA"
Rpattern =              "GAATAGTACTGTAGGCACCATCAATAGATCGGAA"
the function will try to calculate the distance by such coding:
sapply((nchar(subject)-nchar(Rpattern)+1):nchar(subject), function(j)
{
        s = substr(subject, j, nchar(subject))
        p = substr(Rpattern, 1, nchar(subject)-j+1)
        neditEndingAtending.at=nchar(s), pattern = p, subject = s,
with.indels=TRUE)
})
[1]  0  2  4  6  8 10 12 14 15 14 13 12 11 10  9  9  8  7  8  7  6  5
6  6  5  4  4  4  3  2  1  0
[33]  1  1
when the function find the value which is first satisfy the
max.Rmismatch value, it will stop
in this case,they function will stop at the first position.
IF
subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA"
Rpattern =              "GAATAGTACTGTAGGCACCATCAATAGATCGGTT"
The results
[1]  2  3  4  6  8 10 12 14 15 14 13 12 11 10  9  9  8  7  8  7  6  5
6  6  5  4  4  4  3  2  1  0
[33]  1  1
it will stop
in this case,they function will stop at
subject = "TATAGTAGATATTGGAATAGTACTGTAGGCACCATCAATAGATCGGAA"
Rpattern =
"GAATAGTACTGTAGGCACCATCAATAGATCGGTT"
so the shortcoming is the trimLRPatterns cannot find the shared
sequence between subject and Rpattern
"GAATAGTACTGTAGGCACCATCAATAGATCGG"
--
shan gao
Room 231(Dr.Fei lab)
Boyce Thompson Institute
Cornell University
Tower Road, Ithaca, NY 14853-1801
Office phone: 1-607-254-1267(day)
Official email:sg839 at cornell.edu
Facebook:http://www.facebook.com/profile.php?id=100001986532253
                    
                
                