I'll reply on your initial thread as it seems more appropriate. b 2013/6/20 Johnson, Franklin Theodore <franklin.johnson at="" email.wsu.edu="">: > Dr. Carvalho, > Sorry to get back to you first. > According to previous posts, http://comments.gmane.org/gmane.science .biology.informatics.conductor/35367 > I think it the XYS file error above may be related to the pdInfoBuilder annotation package, pd.pdinfo.gpl11164.ndf.txt. > > I went back to make the build the package again using the XYS file. > I get the [[SIGNAL]] error although PROBE_ID <-> SEQ_ID in the NDF file as per previous email in this thread. > Perhaps this is because XYS is sorted 1,1; 1,2; 2,1; 2,2; 3,1; 3,2....but the NDF is not? > ==================================================================== ================================================== > Building annotation package for Nimblegen Expression Array > NDF: GPL11164.ndf > XYS: 01.xys > ==================================================================== ================================================== > Parsing file: GPL11164.ndf... OK > Parsing file: 01.xys... OK > Merging NDF and XYS files... OK > Preparing contents for featureSet table... OK > Preparing contents for bgfeature table... OK > Preparing contents for pmfeature table... OK > Error in parseNgsPair(object at ndfFile, object at xysFile, verbose = !quiet) : > Control probe possibly identified as Experimental > In addition: Warning message: > In is.na(ndfdata[["SIGNAL"]]) : > is.na() applied to non-(list or vector) of type 'NULL' > > As I take a closer look at the ndf file, I do see control probes in the ndf file that are not present in the merged PAIR-XYS files. These are held in CONTAINER= 'NGS_CONTROLS' with PROBE_ID = XENOSYNTH0040, MISMATCH=10007. > However, !is.na()=TRUE throughout the NDF file. Here is another line representing the CONTROLS: > PROBE_DESIGN_ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID PROBE_SEQUENCE MISMATCH MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS PROBE_ID POSITION DESIGN_ID X Y > 7552_0712_1000 NGS_CONTROLS EMPTY dark EMPTY N 0 62990761 62990761 1000 712 control EMPTY 0 7552 712 1000 > > I will look at previous threads that may have mentioned just removing these CONTROLS from the NDF file. > In addition to CONTROLS, there are BLOCK1 and RANDOM types as well. These additional two types can be found in the PAIR file. > > Hope to hear from you soon. > Bittersweet! > Franklin > > Great minds discuss ideas. Average minds discuss events. Small minds discuss people. -Eleanor Roosevelt > > ________________________________________ > From: Johnson, Franklin Theodore > Sent: Wednesday, June 19, 2013 11:25 PM > To: Benilton Carvalho > Cc: bioconductor at r-project.org > Subject: RE: FeatureExpressionSet using list.files() in place of read.xysfiles() > > Dr. Carvalho, > Sorry that was my fault. > Yea. I tried that way at first. But got the message below. >> rawData=read.xysfiles(filelist, pkgname="pd.pdinfo.gpl11164.ndf.txt") > All the XYS files must be of the same type. > Error: checkChipTypes(filenames, verbose, "nimblegen") is not TRUE > The logical for check.names is giving the error. > > Perhaps one of my files is incorrect, which I checked and will triple check... > I tried check.names=FALSE as the error seemed to be a logical on the platform type: >> rawData=read.xysfiles(filelist, pkgname="pd.pdinfo.gpl11164.ndf.txt", check.names=F) > Error: These do not exist: > FALSE > > The XYS files did not work either and gave the same result as xys.txt. >> xys.files=list.xysfiles(getwd(), full.names=TRUE) >> xys.files > [1] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/01.xys" > [2] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/02.xys" > [3] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/03.xys" > [4] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/04.xys" > [5] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/05.xys" > [6] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/06.xys" > [7] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/07.xys" > [8] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/08.xys" > [9] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/09.xys" > [10] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/10.xys" > [11] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/11.xys" > [12] "C:/Users/ZHUGRP/Desktop/New folder/XYS.xys files/12.xys" >> basename(xys.files) > [1] "01.xys" "02.xys" "03.xys" "04.xys" "05.xys" "06.xys" "07.xys" "08.xys" "09.xys" "10.xys" "11.xys" "12.xys" >> ripe=read.xysfiles(xys.files, phenoData=pd) > All the XYS files must be of the same type. > Error: checkChipTypes(filenames, verbose, "nimblegen") is not TRUE > > All XYS files are approximately the same size. So, I see no error with making the XYS files. > Given the error, again, it seems like a logical argument on the check.names for the platform type. > What do you think? > Regards, > Franklin > > ________________________________________ > From: Benilton Carvalho [beniltoncarvalho at gmail.com] > Sent: Wednesday, June 19, 2013 8:53 PM > To: Johnson, Franklin Theodore > Cc: bioconductor at r-project.org > Subject: Re: FeatureExpressionSet using list.files() in place of read.xysfiles() > > Dear Franklin, > > I'm not sure I follow your message... my most sincere apologies... > > Now that you have your XYS files, I was expecting you to simply use: > > library(oligo) > rawData = read.xysfiles(filelist, pkgname='pd.pdinfo.gpl11164.ndf.txt') > > doesn't this work for you? (the 'filelist' variable above contains the > names of your converted XYS files) > > Let me know what are your findings... > > b > > 2013/6/19 Johnson, Franklin Theodore <franklin.johnson at="" email.wsu.edu="">: >> Dear Dr. Carvalho, >> >> Thanks for the reply. >> I saw the thread of FAQs how to read in the annotation package made using pdInfoBuilder. >> For anyone having issues, it seems as straight forward as: >> #install pdinfo.gpl11164.ndf.txt >> install.packages("pd.pdinfo.gpl11164.ndf.txt", type="source", repos=NULL) >> Installing package into ?C:/Users/ZHUGRP/Documents/R/win- library/3.0? >> (as ?lib? is unspecified) >> * installing *source* package 'pd.pdinfo.gpl11164.ndf.txt' ... >> ** R >> ** data >> ** inst >> ** preparing package for lazy loading >> ** help >> *** installing help indices >> ** building package indices >> ** testing if installed package can be loaded >> *** arch - i386 >> *** arch - x64 >> * DONE (pd.pdinfo.gpl11164.ndf.txt) >> ################################################################### ######################################### >> I am currently trying to make the FeatureExpressionSet with my converted PAIR -> XYS.txt files unfortunately obtaining X/Y/S only. >> NimbleScan expected .tiff files to read into the software. These files were not available from NCBI/GEO. NimbleGen also did not respond to my inquiry regarding this matter to be able to obtain XYS files from available PAIR files. Using R, I'm testing 12 of 24 tab-delimited XYS files, to also test the annotation package made using pdInfoBuilder. >> #read in files from wd() >> filelist=list.files(pattern=".*.txt") >>> filelist >> [1] "GSM01.txt" "GSM02.txt" "GSM03.txt" "GSM04.txt" "GSM05.txt" "GSM06.txt" "GSM07.txt" "GSM08.txt" "GSM09.txt" "GSM10.txt" "GSM11.txt" "GSM12.txt" >> #read in each data file in filelist as a matrix to make EFS object >>> datalist=lapply(filelist, function(x)as.matrix(read.table(x, header=T, sep="\t", as.is=T))) >> #construct phenoData frame >>> theData=data.frame(Key=rep(c("Week0","Week-2","Week-4"), each=4)) >>> rownames(theData)=basename(filelist) >>> pd=new("AnnotatedDataFrame", data=theData) >> .... >> However, I fail the EFS construction: >> hardline=new("ExpressionFeatureSet", datalist, phenoData=pd, annotation=library(pd.pdinfo.gpl11164.ndf.txt)) >> Error in .names_found_unique(names(value), names(object)) : >> 'sampleNames' replacement list must have unique named elements corresponding to assayData element names >> To confirm, >>> sampleNames(datalist) >> [1] "X" "Y" "PM" >> So, it seems EFS is expecting unique sampleNames for each file in filelist? >> How to read in multiple files into an efs object, as is done with read.xysfiles? Is this doable? >> >> Is it necessary to execute datalist=lapply(filelist, function(x)as.matrix(read.table(x, header=T, sep="\t", as.is=T))) surrounded with Booleans to make the object TRUE, per se? >> i.e. (datalist=lapply(filelist, function(x)as.matrix(read.table(x, header=T, sep="\t", as.is=T))) ) >> Best Regards, >> Franklin >> >> Great minds discuss ideas. Average minds discuss events. Small minds discuss people. -Eleanor Roosevelt >> >> >> >> >> ________________________________________ >> From: Benilton Carvalho [beniltoncarvalho at gmail.com] >> Sent: Thursday, June 13, 2013 4:43 PM >> To: Johnson, Franklin Theodore >> Cc: bioconductor at r-project.org >> Subject: Re: [BioC] PAIR files -- feature set table >> >> dont worry about that particular warning.... just install the package >> and try to read your XYS files. >> >> 2013/6/13 Johnson, Franklin Theodore <franklin.johnson at="" email.wsu.edu="">: >>> Dr. Carvalho, >>> >>> Yes. I see what you mean. >>> Switching the columns helped in the FeatureSet table loading inserted more >>> that 2 rows: >>> >>> Inserting 198661 rows into table featureSet... OK >>> However, the warning message did print again. >>> >>> >>> Warning message: >>> In is.na(ndfdata[["SIGNAL"]]) : >>> is.na() applied to non-(list or vector) of type 'NULL' >>> >>> Below is the output + sessionInfo(), as I upgraded to R 3.0.1. >>> >>> #Begin R command line code: >>> >>>> makePdInfoPackage(arrays, destDir = getwd(), unlink=TRUE) >>> ================================================================== ====================================================================== ====================== >>> >>> >>> Building annotation package for Nimblegen Expression Array >>> NDF: pdinfo_GPL11164.ndf.txt <-new .ndf file with PROBE_ID<->SEQ_ID >>> XYS: XYS.txt >>> ================================================================== ====================================================================== ====================== >>> Parsing file: pdinfo_GPL11164.ndf.txt... OK >>> >>> Parsing file: XYS.txt... OK >>> Merging NDF and XYS files... OK >>> Preparing contents for featureSet table... OK >>> Preparing contents for bgfeature table... OK >>> Preparing contents for pmfeature table... OK >>> Creating package in E:/RANDOM/Test/Yanmin's Microarray Paper/Yanmin >>> Microarray RAW/pd.pdinfo.gpl11164.ndf.txt >>> Inserting 198661 rows into table featureSet... OK >>> Inserting 770599 rows into table pmfeature... OK >>> >>> Counting rows in featureSet >>> Counting rows in pmfeature >>> Creating index idx_pmfsetid on pmfeature... OK >>> Creating index idx_pmfid on pmfeature... OK >>> Creating index idx_fsfsetid on featureSet... OK >>> Saving DataFrame object for PM. >>> Done. >>> Warning message: >>> In is.na(ndfdata[["SIGNAL"]]) : >>> is.na() applied to non-(list or vector) of type 'NULL' >>> >>> >>>> sessionInfo() >>> R version 3.0.1 (2013-05-16) >>> Platform: i386-w64-mingw32/i386 (32-bit) >>> >>> locale: >>> [1] LC_COLLATE=English_United States.1252 LC_CTYPE=English_United >>> States.1252 LC_MONETARY=English_United States.1252 >>> [4] LC_NUMERIC=C LC_TIME=English_United >>> States.1252 >>> >>> attached base packages: >>> [1] parallel stats graphics grDevices utils datasets methods >>> base >>> >>> other attached packages: >>> [1] pdInfoBuilder_1.24.0 oligo_1.24.0 oligoClasses_1.22.0 >>> affxparser_1.32.1 RSQLite_0.11.4 DBI_0.2-7 >>> Biobase_2.20.0 >>> [8] BiocGenerics_0.6.0 BiocInstaller_1.10.2 >>> >>> loaded via a namespace (and not attached): >>> [1] affyio_1.28.0 Biostrings_2.28.0 bit_1.1-10 >>> codetools_0.2-8 ff_2.2-11 foreach_1.4.1 >>> GenomicRanges_1.12.4 >>> [8] IRanges_1.18.1 iterators_1.0.6 preprocessCore_1.22.0 >>> splines_3.0.1 stats4_3.0.1 tools_3.0.1 >>> zlibbioc_1.6.0 >>> >>> >>> >>>>q() >>> >>> >>> >>> The built pdInfopackage loaded in Destdir is identical to previous message. >>> >>> However the featureSet table now has more than 2 rows... >>> >>> Lastly, I did multiple combos, as my merged file has (X.x, Y.x)<-seems to be >>> identifiers for the 'probe IDs' on the array as well as (X.y, Y.y) <- seems >>> to be the sequence identifiers for the "SEQ_ID". I used X.x, Y.x and PM >>> which gave the result I pasted above. All others had errors. I'm close, but >>> that Warning Message is annoying... >>> >>> >>> >>> Regards, >>> >>> Franklin >>> >>> >>> Great minds discuss ideas. Average minds discuss events. Small minds discuss >>> people. -Eleanor Roosevelt >>> >>> >>> >>> >>> ________________________________________ >>> From: Benilton Carvalho [beniltoncarvalho at gmail.com] >>> Sent: Wednesday, June 12, 2013 8:25 PM >>> >>> To: Johnson, Franklin Theodore >>> Cc: bioconductor at r-project.org >>> Subject: Re: [BioC] PAIR files -- feature set table >>> >>> That does not look ok. >>> >>> The problem is the count for the featureSet table... This table stores >>> the information for "genes" (or whatever the target for this >>> particular array is)... so, it is unlikely that you have a microarray >>> with only 2 "target units"... I'd expect something around the >>> thousands... >>> >>> pdInfoBuilder uses the information in SEQ_ID (in the NDF) to get the >>> target information (i.e., the contents for featureSet). >>> >>> Given that this is a custom array, I believe that the best idea is to >>> contact the person who designed it and ask more details about the >>> design (in particular, how many probesets and average number of probes >>> per probeset)... >>> >>> I've seen some designs in which the information that was expected to >>> be in SEQ_ID was actually stored in PROBE_ID (in such cases, the user >>> needs to create a backup copy of the NDF, and then move the contents >>> of PROBE_ID to SEQ_ID - and vice-versa). >>> >>> b >>> >>> 2013/6/12 Johnson, Franklin Theodore <franklin.johnson at="" email.wsu.edu="">: >>>> Dear Dr. Carvalho, >>>> >>>> Recently, we had cooresponence regaring makePDInfoPackage for an NimbleGen >>>> apple microarray. >>>> I was able to merge the ndf design and XYS files using PROBE_ID. >>>> As a reminder this is a custom array, and there are no SIGNAL==NAs for >>>> control probes. >>>> It seemed to work: >>>>> makePdInfoPackage(seed, destDir("")) >>>> >>>> ================================================================= ====================================================================== ===================== >>>> Building annotation package for Nimblegen Expression Array >>>> NDF: GPL11164.ndf >>>> XYS: XYS.txt >>>> >>>> ================================================================= ====================================================================== ===================== >>>> Parsing file: GPL11164.ndf... OK >>>> Parsing file: XYS.txt... OK >>>> Merging NDF and XYS files... OK >>>> Preparing contents for featureSet table... OK >>>> Preparing contents for bgfeature table... OK >>>> Preparing contents for pmfeature table... OK >>>> Creating package in >>>> C:/Users/franklin.johnson.PW50-WEN/Desktop/Test/Yanmin's Microarray >>>> Paper/Yanmin Microarray RAW/pd.gpl11164 >>>> Inserting 2 rows into table featureSet... OK >>>> Inserting 765524 rows into table pmfeature... OK >>>> Inserting 5075 rows into table bgfeature... OK >>>> Counting rows in bgfeature >>>> Counting rows in featureSet >>>> Counting rows in pmfeature >>>> Creating index idx_bgfsetid on bgfeature... OK >>>> Creating index idx_bgfid on bgfeature... OK >>>> Creating index idx_pmfsetid on pmfeature... OK >>>> Creating index idx_pmfid on pmfeature... OK >>>> Creating index idx_fsfsetid on featureSet... OK >>>> Saving DataFrame object for PM. >>>> Saving DataFrame object for BG. >>>> Done. >>>> Warning message: >>>> In is.na(ndfdata[["SIGNAL"]]) : >>>> is.na() applied to non-(list or vector) of type 'NULL' >>>>> >>>> >>>> In contrast to this warning message, I see a pdinfopackage directory with >>>> 4 subdirectories: c=("data", "inst", "man", R"), as well as >>>> subsubdirectories in "inst"=c("extdata", and "Unit Tests"), in addition to >>>> two text files in the main directory: c=("DESCRIPTION", "NAMESPACE") were >>>> created in my destination folder. >>>> Before using "oligo", if possible, I wanted to confirm with you that this >>>> package is viable to use with "oligo" although a warning message that may >>>> not pertain to my custom designed microarray was printed. >>>> >>>> Regards, >>>> Franklin >>>> >>>> Great minds discuss ideas. Average minds discuss events. Small minds >>>> discuss people. -Eleanor Roosevelt >>>> >>>> >>>> >>>> >>>> ________________________________________ >>>> From: Johnson, Franklin Theodore >>>> Sent: Friday, June 07, 2013 10:39 AM >>>> To: Benilton Carvalho >>>> Cc: bioconductor at r-project.org >>>> Subject: RE: [BioC] PAIR files -- feature set table >>>> >>>> Resending to bioconductor message thread: >>>> >>>> Dear Dr. Carvalho, >>>> Thanks for the response. >>>> As you suggested, I will look into the merge function using "Probe_ID". >>>> After reading in the data, I will start here: merge.datasets(dataset1, >>>> dataset2, by="key"). >>>> Best Regards, >>>> Franklin >>>> >>>> Great minds discuss ideas. Average minds discuss events. Small minds >>>> discuss people. -Eleanor Roosevelt >>>> >>>> ________________________________________ >>>> From: Benilton Carvalho [beniltoncarvalho at gmail.com] >>>> Sent: Thursday, June 06, 2013 8:11 PM >>>> To: Johnson, Franklin Theodore >>>> Cc: bioconductor at r-project.org; franklin.johnson at wsu.edu >>>> Subject: Re: [BioC] PAIR files -- feature set table >>>> >>>> You will need to merge the PAIR and the NDF using the PROBE_ID column >>>> as key. This will allow you to get the X/Y coordinates needed to >>>> create the XYS as described on the other messages. >>>> >>>> Regarding annotation, you may need to contact NimbleGen to request >>>> this information directly from them... >>>> >>>> benilton >>>> >>>> 2013/6/6 Johnson, Franklin Theodore <franklin.johnson at="" email.wsu.edu="">: >>>>> Dear Dr. Carvalho, >>>>> >>>>> Muchos grasias for the reply. >>>>> >>>>> Actually, this is what my .ndf file looks like: >>>>>> head(ndf) >>>>> PROBE_DESIGN_ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID >>>>> 1 7552_0343_0009 Duplicate_1 >>>>> 2 7552_0345_0009 Duplicate_2 >>>>> 3 7552_0347_0009 Duplicate_1 >>>>> 4 7552_0349_0009 Duplicate_2 >>>>> 5 7552_0351_0009 Duplicate_2 >>>>> 6 7552_0353_0009 Duplicate_1 >>>>> PROBE_SEQUENCE MISMATCH >>>>> MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS >>>>> 1 cttgactcttctaagttcaaaggtaactcaagtgaagctgtcagatatgatccttcca 0 >>>>> 64535488 64535488 9 343 >>>>> 2 cccaagcattaaaccttactcatatacttataatgcagccatcaagagtttgtgcaagg 0 >>>>> 64799310 64799310 9 345 >>>>> 3 agggaggctgaaagagagagtgaatggtccagctgggcataattgctgca 0 >>>>> 64476989 64476989 9 347 >>>>> 4 ttgttggtgggggtgttgcccttagtaccccagaccttgaagcagttaaa 0 >>>>> 64862794 64862794 9 349 >>>>> 5 gtgtggggccccctttctttaactggaacctttctttgaagcaatttggg 0 >>>>> 64832726 64832726 9 351 >>>>> 6 ttgtccaattccaacatgccgagacggcagggattgtgatcgtgttgttc 0 >>>>> 64435686 64435686 9 353 >>>>> PROBE_ID POSITION DESIGN_ID X Y >>>>> 1 Contig19819_1_f_28_10_535 0 7552 343 9 >>>>> 2 Malus_CN899188_2_f_147_1_755 0 7552 345 9 >>>>> 3 Contig20738_8_r_1179_2_1432 0 7552 347 9 >>>>> 4 Malus_CN880097_2_r_336_2_536 0 7552 349 9 >>>>> 5 Malus_CN918117_2_f_632_1_781 0 7552 351 9 >>>>> 6 Contig1991_1_f_71_2_1239 0 7552 353 9 >>>>> >>>>> The pair files, .532 pair files only (one-color arrays), only obtain the >>>>> probe ID and signal; after some text at the top describing the experiment. >>>>> My real issue is that I can further normalize and analyze the RMA files with >>>>> sva and limma, etc. However, I cannot annotate the probes without the array >>>>> annotation, as there are duplicates in the ndf file which are removed in the >>>>> RMA.pair files available on NCBI/GEO. So they will not match in any >>>>> annotation package I've failed at trying. >>>>> So, I' tried to go back and start from the raw pair files...this custom >>>>> array is really a "custom" array without >>>>> NimbleScan. >>>>> >>>>> Salud, >>>>> Franklin >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> Great minds discuss ideas. Average minds discuss events. Small minds >>>>> discuss people. -Eleanor Roosevelt >>>>> >>>>> >>>>> >>>>> >>>>> ________________________________________ >>>>> From: Benilton Carvalho [beniltoncarvalho at gmail.com] >>>>> Sent: Wednesday, June 05, 2013 6:42 PM >>>>> To: FRANKLIN JOHNSON [guest] >>>>> Cc: bioconductor at r-project.org; franklin.johnson at wsu.edu; pdInfoBuilder >>>>> Maintainer >>>>> Subject: Re: [BioC] PAIR files -- feature set table >>>>> >>>>> It's an unfortunate mistake to have the pairFile *argument* in the >>>>> call (not in the slots session, but I see your point). :-( I'll make >>>>> sure that this is fixed. >>>>> >>>>> You need to convert the PAIR files to XYS... >>>>> >>>>> Some refs that should help you in the process: >>>>> >>>>> https://stat.ethz.ch/pipermail/bioconductor/2012-January/043186.html >>>>> >>>>> http://comments.gmane.org/gmane.science.biology.informatics.cond uctor/27547 >>>>> >>>>> b >>>>> >>>>> 2013/6/5 FRANKLIN JOHNSON [guest] <guest at="" bioconductor.org="">: >>>>>> >>>>>> Dear Maintainer, >>>>>> >>>>>> I downloaded available NimbleGen 'single channel' 532.PAIR files for a >>>>>> custom built expression microarray from NCBI/GEO (GPL11164). However, I get >>>>>> an error message when I try to make the annotation for this platform using >>>>>> pdInfoBuild. >>>>>> >>>>>> In pdInfoBuilder Reference Manual (June 5, 2013), under the >>>>>> NgsExpressionPDInfoPkgSeed method, there is a slot for pairFile, although, >>>>>> showClasses("Ngs.."), does not show a slot for this, only, XYS. Thus, I >>>>>> changed the .pair file extension to .xys. >>>>>> >>>>>> (ndf<- list.files(getwd(), pattern=".ndf", full.names=TRUE)) # read >>>>>> annotation file >>>>>> [1] "C:/Users/franklin.johnson.PW99-WEN/Desktop/Test/Yanmin's Microarray >>>>>> Paper/Yanmin Microarray RAW/GPL11164.ndf" >>>>>> >>>>>> (xys <- list.files(getwd(), pattern = ".xys", full.names = TRUE)[1]) >>>>>> [1] "C:/Users/franklin.johnson.PW99-WEN/Desktop/Test/Yanmin's Microarray >>>>>> Paper/Yanmin Microarray RAW/GSM618107_14418002_532.xys" >>>>>> >>>>>> But, doing this resulted in an error message: >>>>>> seed <- new("NgsExpressionPDInfoPkgSeed", ndfFile = ndf, xysFile = xys, >>>>>> author = "FJ", organism = "Apple", species = "Malus x Domestica cv.GD") >>>>>> >>>>>> makePdInfoPackage(arrays, destDir = getwd()) >>>>>> >>>>>> =============================================================== ====================================================================== ======= >>>>>> Building annotation package for Nimblegen Expression Array >>>>>> NDF: GPL11164.ndf >>>>>> XYS: GSM618107_14418002_532.xys >>>>>> >>>>>> =============================================================== ====================================================================== ======= >>>>>> Parsing file: GPL11164.ndf... OK >>>>>> Parsing file: GSM618107_14418002_532.xys... OK >>>>>> Merging NDF and XYS files... OK >>>>>> Preparing contents for featureSet table... Error in >>>>>> `[.data.frame`(ndfdata, , colsFS) : undefined columns selected >>>>>> In addition: Warning message: >>>>>> In is.na(ndfdata[["SIGNAL"]]) : >>>>>> is.na() applied to non-(list or vector) of type 'NULL' >>>>>> >>>>>> The only files available from NCBI/GEO are 24 PAIR files and 1 ndf. It >>>>>> seems .xys has a different arrangement than .pair, thus .ndf is not >>>>>> applicable to annotate the .pair file? Any suggestions? >>>>>> Hope to hear from you soon. >>>>>> Franklin >>>>>> >>>>>> -- output of sessionInfo(): >>>>>> >>>>>>> sessionInfo() >>>>>> R version 3.0.1 (2013-05-16) >>>>>> Platform: x86_64-w64-mingw32/x64 (64-bit) >>>>>> >>>>>> locale: >>>>>> [1] LC_COLLATE=English_United States.1252 LC_CTYPE=English_United >>>>>> States.1252 LC_MONETARY=English_United States.1252 >>>>>> [4] LC_NUMERIC=C LC_TIME=English_United >>>>>> States.1252 >>>>>> >>>>>> attached base packages: >>>>>> [1] tcltk grid parallel stats graphics grDevices utils >>>>>> datasets methods base >>>>>> >>>>>> other attached packages: >>>>>> [1] pdInfoBuilder_1.24.0 oligo_1.24.0 oligoClasses_1.22.0 >>>>>> affxparser_1.32.1 RSQLite_0.11.4 DBI_0.2-7 >>>>>> [7] Mfuzz_2.18.0 DynDoc_1.38.0 widgetTools_1.38.0 >>>>>> e1071_1.6-1 class_7.3-7 gplots_2.11.0.1 >>>>>> [13] KernSmooth_2.23-10 caTools_1.14 gdata_2.12.0.2 >>>>>> gtools_2.7.1 timecourse_1.32.0 MASS_7.3-26 >>>>>> [19] Biobase_2.20.0 BiocGenerics_0.6.0 limma_3.16.5 >>>>>> ggplot2_0.9.3.1 BiocInstaller_1.10.1 >>>>>> >>>>>> loaded via a namespace (and not attached): >>>>>> [1] affyio_1.28.0 Biostrings_2.28.0 bit_1.1-10 >>>>>> bitops_1.0-5 codetools_0.2-8 colorspace_1.2-2 >>>>>> [7] dichromat_2.0-0 digest_0.6.3 ff_2.2-11 >>>>>> foreach_1.4.0 GenomicRanges_1.12.4 gtable_0.1.2 >>>>>> [13] IRanges_1.18.1 iterators_1.0.6 labeling_0.1 >>>>>> marray_1.38.0 munsell_0.4 plyr_1.8 >>>>>> [19] preprocessCore_1.22.0 proto_0.3-10 RColorBrewer_1.0-5 >>>>>> reshape2_1.2.2 scales_0.2.3 splines_3.0.1 >>>>>> [25] stats4_3.0.1 stringr_0.6.2 tkWidgets_1.38.0 >>>>>> tools_3.0.1 zlibbioc_1.6.0 >>>>>>> >>>>>> >>>>>> >>>>>> -- >>>>>> Sent via the guest posting facility at bioconductor.org. >>>>>> >>>>>> _______________________________________________ >>>>>> Bioconductor mailing list >>>>>> Bioconductor at r-project.org >>>>>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>>>>> Search the archives: >>>>>> http://news.gmane.org/gmane.science.biology.informatics.conductor >>>>> >>>>> >>>>> _______________________________________________ >>>>> Bioconductor mailing list >>>>> Bioconductor at r-project.org >>>>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>>>> Search the archives: >>>>> http://news.gmane.org/gmane.science.biology.informatics.conductor >>>>