If I have a GRanges, I was expecting to be able to instantiate a Views like

 ntv <- Views(Mmusculus, granges(BS))
 Error in (function (classes, fdef, mtable)  :
   unable to find an inherited method for function ‘Views’ for signature ‘"BSgenome"’

I assume this is because I need to instantiate a separate Views on each chromosome.  That is tedious.  Is there an easy fix?

Best,
Kasper

Hi Kasper,

Yes instantiating a separate Views on each chromosome would be tedious. I just added the BSgenomeViews class to BSgenome 1.35.6 (this is in BioC devel) so now you can do:

library(BSgenome.Mmusculus.UCSC.mm10)
genome <- BSgenome.Mmusculus.UCSC.mm10

library(TxDb.Mmusculus.UCSC.mm10.knownGene)
txdb <- TxDb.Mmusculus.UCSC.mm10.knownGene
ex <- exons(txdb, columns=c("tx_name", "gene_id"))

v <- Views(genome, ex)

Then:

> v
BSgenomeViews object with 254827 views and 2 metadata columns:
           seqnames               ranges strand                       dna   |
              <Rle>            <IRanges>  <Rle>            <DNAStringSet>   |
       [1]     chr1   [4807893, 4807982]      + [GCACTGTCCG...CACCGCCGCG]   |
       [2]     chr1   [4808455, 4808486]      + [GTTATTTTCC...GAGATACAGG]   |
       [3]     chr1   [4828584, 4828649]      + [GCATGGATGG...GTCCACATGC]   |
       [4]     chr1   [4830268, 4830315]      + [CCCTGTGATG...TGCCTTCTTG]   |
       [5]     chr1   [4832311, 4832381]      + [GTTTGATATC...GCAGAAACCG]   |
       ...      ...                  ...    ...                       ... ...
  [254823]     chrY [90531602, 90531635]      - [GCGGTTGGGA...TAGATGAGCT]   |
  [254824]     chrY [90603501, 90603569]      - [GTTTGAAGTC...CTCATCATCG]   |
  [254825]     chrY [90604098, 90604282]      - [ACCCAGGAGA...ACTGCATGAG]   |
  [254826]     chrY [90605010, 90605191]      - [AGACATCCTG...TGATGAAGGA]   |
  [254827]     chrY [90605679, 90605864]      - [GGCCTTGCTC...TCTCCAGAAG]   |
                         tx_name         gene_id
                 <CharacterList> <CharacterList>
       [1] uc007afg.1,uc007afh.1           18777
       [2] uc007afg.1,uc007afh.1           18777
       [3] uc007afg.1,uc007afh.1           18777
       [4] uc007afg.1,uc007afh.1           18777
       [5] uc007afg.1,uc007afh.1           18777
       ...                   ...             ...
  [254823]            uc029ygu.1              NA
  [254824]            uc029ygv.1              NA
  [254825]            uc029ygv.1              NA
  [254826]            uc029ygv.1              NA
  [254827]            uc029ygv.1              NA
  -------
  seqinfo: 66 sequences (1 circular) from mm10 genome

This is just a BSgenome object and a GRanges object bundle together. You can get them back with:

subject(v)
granges(v)

You can use [[ to extract a given sequence:

> v[[2]]
  32-letter "DNAString" instance
seq: GTTATTTTCCTTCACGGATTGGGAGATACAGG

or coerce to DNAStringSet to extract them all:

as(v, "DNAStringSet")  # might take a while

Some of the most frequently used DNAStringSet methods work on v:

> alphabetFrequency(v, collapse=TRUE)
       A        C        G        T        M        R        W        S 
21951343 20431781 20686000 21448065        0        0        0        0 
       Y        K        V        H        D        B        N        - 
       0        0        0        0        0        0        2        0 
       +        . 
       0        0 

More could be added...

Will add a man page for this new class. Let me know on the bioc-devel mailing list how it goes for you.

H.

Herve,

Thanks a lot (that was quick!), I will test this in the next couple of days when it has propagated to the build system.

Best,
Kasper