krababah<https: support.bioconductor.org="" u="" 10712=""/> , What is your goal? If you are trying to design gRNAs with minimized off-target effects and maximized efficacy (efficiency), please take a look at the output files OfftargetAnalysis.xls (detailed information of off targets) and Summary.xls (summary of the gRNAs with efficacy and topN offtarget score). Also, you might want to set scoring.method = "CFDscore" to use a different off target scoring method. Here is a list of documentations that might be helpful. http://bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.pdf http://bioconductor.org/packages/release/bioc/manuals/CRISPRseek/man/CRISPRseek.pdf http://www.bioconductor.org/help/course-materials/2014/BioC2014/CRISPRseek-forBioc2014.pdf http://mccb.umassmed.edu/bioinformatics/workshop/CRISPRseekWorkshopSept10th2014-pgfeUmass.pdf http://mccb.umassmed.edu/bioinformatics/workshop/CRISPRdemo.Rmd Zhu LJ*, Holmes BR, Aronin N and Brodsky MH*. (2014) CRISPRseek: a Bioconductor package to identify target-specific guide RNAs for CRISPR-Cas9 genome-editing systems. PloS One Sept 23rd 2014 Zhu LJ (2015). Overview of guide RNA design tools for CRISPR-Cas9 genome editing technology. Front. Biol., 10(4) Best, Julie From: "krababah [bioc]" <noreply@bioconductor.org<mailto:noreply@bioconductor.org>> Reply-To: "reply+e58873dd+code@bioconductor.org<mailto:reply+e58873dd+code@bioconductor.org>" <reply+e58873dd+code@bioconductor.org<mailto:reply+e58873dd+code@bioconductor.org>> Date: Wednesday, May 18, 2016 2:32 AM To: Lihua Julie Zhu <julie.zhu@umassmed.edu<mailto:julie.zhu@umassmed.edu>> Subject: [bioc] offTargetAnalysis result interpretation Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User krababah<https: support.bioconductor.org="" u="" 10712=""/> wrote Question: offTargetAnalysis result interpretation<https: support.bioconductor.org="" p="" 82765=""/>: Hi, I just started using CRISPRseek application, thanks to Dr.Julie Zhu to walk me through issues that got resolved. I called the offTargetAnalysis function as shown below: offTargetAnalysis(inputFilePath, findgRNAsWithREcutOnly = FALSE, + REpatternFile = REpatternFile, findPairedgRNAOnly = FALSE, BSgenomeName = Hsapiens,txdb = TxDb.Hsapiens.UCSC.hg19.knownGene, max.mismatch = 3, chromToSearch = "",outputDir = outputDir, overwrite = TRUE) the input file was : 45 GACCCACGCCTGCTCCCTCATCCACTGTGTGCACTTCATCCTGGA rs362331C then i got results : A DNAStringSet instance of length 7 width seq names [1] 23 CCACTGTGTGCACTTCATCCTGG rs362331C_gR38f [2] 23 CCAGGATGAAGTGCACACAGTGG rs362331C_gR28r [3] 23 TGAAGTGCACACAGTGGATGAGG rs362331C_gR22r [4] 23 GAAGTGCACACAGTGGATGAGGG rs362331C_gR21r [5] 23 CACACAGTGGATGAGGGAGCAGG rs362331C_gR15r [6] 23 AGTGGATGAGGGAGCAGGCGTGG rs362331C_gR10r [7] 23 GTGGATGAGGGAGCAGGCGTGGG rs362331C_gR9r beside other *.xls files. The problem that i have is that i do not know to interpret those results, How can i build needed knowledge that will enable me to read, comprehend those results. Thanks ________________________________ Post tags: crisprseek You may reply via email or visit offTargetAnalysis result interpretation