Question

getProbeInfo and exprs return two different dimensions

0

Entering edit mode

Haoran • 0

@46f52cee

Last seen 2.5 years ago

United States

Hi, I was trying to get intensity and annotation for affymetrix microarray probes. I extract probe-level intensity and probe annotations using "getProbeInfo" and "exprs" command from oligo, but the result shows exprs() has a smaller dimension than the dataframe I got using getProbeInfo()

I download my CEL file from GEO, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE147788

Series GSE147788

please help me,

##Probe intensity
> pro_int <- exprs(data.raw)
> head(pro_int)
  GSM4445944_9SR20982A_A01.CEL.gz GSM4445946_9SR20982A_A03.CEL.gz
1                            7097                            8199
2                             269                             226
3                            7148                            7855
4                             161                             162
5                             188                             197
6                             202                             252
> dim(pro_int)
[1] 6892960       2

> ##probe f-id
> pin <- oligo::getProbeInfo(data.raw)
> head(pin)
  fid         man_fsetid
1   6 PSR1700199794.hg.1
2   8           24657315
3   8 PSR1300152110.hg.1
4   9 PSR0200224250.hg.1
5  11           24587906
6  11 PSR0300183028.hg.1
> dim(pin)
[1] 8132393       2

CELfile MicroarrayData AffymetrixChip • 1.1k views

ADD COMMENT • link 2.6 years ago Haoran • 0

score 0 · Answer 1 · 2022-03-25

0

Entering edit mode

James W. MacDonald 67k

@james-w-macdonald-5106

Last seen 1 day ago

United States

It appears like you still have the probe level data. If you do

dat <- rma(data raw)

The result will then be at the transcript level and should match your annotation data.

ADD COMMENT • link 2.6 years ago James W. MacDonald 67k

0

Entering edit mode

Thanks James, but what I want to do is find probes that contain SNPs. I already got the probe_id for probes that have snps. for example:
probe_id probe_sequence probe_seqname probe_strand probe_start probe_stop probe_blocks RSID1

2769426 CACACTGCTTTCTTTCTGGAGCTAA chr3 - 23762 23786 23762-23786 rs139173350

765447 TTTTCACACTGCTTTCTTTCTGGAG chr3 - 23766 23790 23766-23790 rs139173350

2664564 ATCTTTTTCACACTGCTTTCTTTCT chr3 - 23770 23794 23770-23794 rs139173350

3187315 TTTCATCTTTTTCACACTGCTTTCT chr3 - 23774 23798 23774-23798 rs139173350

65454 TGTGTTTCATCTTTTTCACACTGCT chr3 - 23778 23802 23778-23802 rs139173350

364306 AATCTGTGTTTCATCTTTTTCACAC chr3 - 23782 23806 23782-23806 rs139173350

5702188 AGTGTGTTGTCTGTTGCCAAGGGTT chr3 - 24046 24070 24046-24070 rs559636578

Now I just want to link this dataframe with probe intensity of the CEL file, what should I do? What I got is the Probe_id from the example, all probe intensity from CEL file, and the annotation that do not match the probe number in CEl file...

ADD REPLY • link 2.6 years ago Haoran • 0

0

Entering edit mode

The probe_id in the data you present above is the same thing as what oligo calls the 'fid'. It also happens to be the row.name for the raw data. I downloaded one of the files you are using as an example.

> raw.data <- read.celfiles("GSM4445944_9SR20982A_A01.CEL.gz")
Platform design info loaded.
Reading in : GSM4445944_9SR20982A_A01.CEL.gz
> head(exprs(raw.data))
  GSM4445944_9SR20982A_A01.CEL.gz
1                            7097
2                             269
3                            7148
4                             161
5                             188
6                             202

## read in your data
> snp.dat <- matrix(scan("clipboard", "c"), ncol = 8, byrow = TRUE)
Read 56 items
> snp.dat
     [,1]      [,2]                        [,3]   [,4] [,5]    [,6]   
[1,] "2769426" "CACACTGCTTTCTTTCTGGAGCTAA" "chr3" "-"  "23762" "23786"
[2,] "765447"  "TTTTCACACTGCTTTCTTTCTGGAG" "chr3" "-"  "23766" "23790"
[3,] "2664564" "ATCTTTTTCACACTGCTTTCTTTCT" "chr3" "-"  "23770" "23794"
[4,] "3187315" "TTTCATCTTTTTCACACTGCTTTCT" "chr3" "-"  "23774" "23798"
[5,] "65454"   "TGTGTTTCATCTTTTTCACACTGCT" "chr3" "-"  "23778" "23802"
[6,] "364306"  "AATCTGTGTTTCATCTTTTTCACAC" "chr3" "-"  "23782" "23806"
[7,] "5702188" "AGTGTGTTGTCTGTTGCCAAGGGTT" "chr3" "-"  "24046" "24070"
     [,7]          [,8]         
[1,] "23762-23786" "rs139173350"
[2,] "23766-23790" "rs139173350"
[3,] "23770-23794" "rs139173350"
[4,] "23774-23798" "rs139173350"
[5,] "23778-23802" "rs139173350"
[6,] "23782-23806" "rs139173350"
[7,] "24046-24070" "rs559636578"

> exprs(raw.data)[as.numeric(snp.dat[,1]),,drop = FALSE]
        GSM4445944_9SR20982A_A01.CEL.gz
2769426                              34
765447                               44
2664564                              48
3187315                              31
65454                                26
364306                               35
5702188                              75