Hi, I'm trying to get up and running to use openPrimer but am having some issues and would appreciate any guidance.

1. I get an error if I tag any primers as reverse. These go away if all primers are forward.
2. All melt temperature results using check_constraints are "NA".
3. Additional constraints throw new errors, but maybe because of #2? ... so one thing at a time.

I believe I have dependencies installed, working and accessible from my R terminal:

> library('openPrimeR')
The number of cores for was set to '2' by 'parallel_setup()'.

----------

system("melting -V")
    NN_PATH = /usr/local/share/MELTING/Data
    CLASSPATH = /usr/local/bin/melting5.jar
    options = '-V'

    This MELTING program is the version 5.2.0.

----------

system("RNAfold -V")
    RNAfold 2.5.0

-----------

system("hybrid-min -V")
    hybrid-min (OligoArrayAux) 3.8
    By Nicholas R. Markham and Michael Zuker
    Copyright (C) 2006
    Rensselaer Polytechnic Institute
    Troy, NY 12810-3590 USA

------------

> system("mafft --help")
    ------------------------------------------------------------------------------
      MAFFT v7.490 (2021/Oct/30)
      https://mafft.cbrc.jp/alignment/software/
      MBE 30:772-780 (2013), NAR 30:3059-3066 (2002)
    ------------------------------------------------------------------------------

I am able to import primers and templates, and even run a limited set of check_constraints:

# load primers
primer_obj <- read_primers(fname="cdc_sars2.fas")

Identifier         ID                       Forward              Reverse                     primer_length_fw   primer_length_rev   Direction   Degeneracy_fw   Degeneracy_rev  Run
1fw                2019-nCoV_N1-F|N1_fw     gaccccaaaatcagcgaaat                              20                0                   fw           1                          1   cdc_sars2
2rev               2019-nCoV_N1-R|N1_rev                          tctggttactgccagttgaatctg    0                 24                  rev          1                          1   cdc_sars2

# load template
template_obj <- read_templates(fname="sars_cov_2_template.fasta")

# load settings file
   filename <- system.file("extdata", "settings",
                           "B_Taq_PCR_evaluate.xml", package = "openPrimeR")
    taq_settings <- read_settings(filename)

# Evaluate limited constraints found in 'settings'
    constraint.df <- check_constraints(primer.df=primer_obj, template.df=template_obj, 
                                       settings=taq_settings, active.constraints =  c("primer_length", "gc_clamp", "gc_ratio", "no_runs", "no_repeats"))

## SUCCESS ##

Additional constraints lead to errors

# Evaluate limited constraints found in 'settings'
    constraint.df <- check_constraints(primer.df=primer_obj, template.df=template_obj, 
                                       settings=taq_settings, active.constraints =  c("primer_length", "gc_clamp", "gc_ratio", "no_runs", "no_repeats", "melting_temp_range"))

## Error in read.table unless I code all primers as forward primers
    Error in read.table(file = file, header = header, sep = sep, quote = quote,  : 
      no lines available in input
    Error in read.table(file = file, header = header, sep = sep, quote = quote,  : 
      no lines available in input

# Rerun with 2019-nCoV_N1-R|N1_rev changed to 2019-nCoV_N1-R|N1_fw

Warning messages:
    1: In min(c(Tm.fw$Tm_C_fw[x], Tm.rev$Tm_C_rev[x]), na.rm = TRUE) :
        no non-missing arguments to min; returning Inf
    2: In min(c(Tm.fw$Tm_C_fw[x], Tm.rev$Tm_C_rev[x]), na.rm = TRUE) :
       no non-missing arguments to min; returning Inf

## FAIL - table is produced but all Tm values are empty (NA)

Including templates for reproducibility:

> NC_045512|Wuhan01
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCC

> EPI_ISL_7190366|Omicron
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACTCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACA

> EPI_ISL_1080064|B.1.243
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCGATTCAACTGGCAGTAACCAGCATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGTTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCG

sessionInfo( )
R version 4.2.0 (2022-04-22)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 20.04.4 LTS

Matrix products: default
BLAS:   /usr/lib/x86_64-linux-gnu/blas/libblas.so.3.9.0
LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.9.0

locale:
 [1] LC_CTYPE=C.UTF-8       LC_NUMERIC=C           LC_TIME=C.UTF-8        LC_COLLATE=C.UTF-8     LC_MONETARY=C.UTF-8    LC_MESSAGES=C.UTF-8    LC_PAPER=C.UTF-8       LC_NAME=C              LC_ADDRESS=C          
[10] LC_TELEPHONE=C         LC_MEASUREMENT=C.UTF-8 LC_IDENTIFICATION=C   

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
[1] openPrimeR_1.18.0

loaded via a namespace (and not attached):
 [1] Rcpp_1.0.8.3            plyr_1.8.7              RColorBrewer_1.1-3      pillar_1.7.0            compiler_4.2.0          GenomeInfoDb_1.32.1     XVector_0.36.0          iterators_1.0.14       
 [9] zlibbioc_1.42.0         bitops_1.0-7            tools_4.2.0             lifecycle_1.0.1         tibble_3.1.7            gtable_0.3.0            pkgconfig_2.0.3         rlang_1.0.2            
[17] foreach_1.5.2           rstudioapi_0.13         DBI_1.1.2               cli_3.3.0               parallel_4.2.0          GenomeInfoDbData_1.2.8  stringr_1.4.0           dplyr_1.0.9            
[25] generics_0.1.2          Biostrings_2.64.0       vctrs_0.4.1             S4Vectors_0.34.0        IRanges_2.30.0          stats4_4.2.0            grid_4.2.0              tidyselect_1.1.2       
[33] glue_1.6.2              R6_2.5.1                fansi_1.0.3             reshape2_1.4.4          ggplot2_3.3.6           purrr_0.3.4             magrittr_2.0.3          codetools_0.2-18       
[41] GenomicRanges_1.48.0    scales_1.2.0            ellipsis_0.3.2          BiocGenerics_0.42.0     assertthat_0.2.1        colorspace_2.0-3        utf8_1.2.2              stringi_1.7.6          
[49] lpSolveAPI_5.5.2.0-17.7 doParallel_1.0.17       RCurl_1.98-1.6          munsell_0.5.0           crayon_1.5.1