RSubread cellCounts - memory mapping error with NovoSeq but not NextSeq output
0
1
Entering edit mode
@c6be64d3
Last seen 6 weeks ago
USA

Hello, I'm trying to use RSubread's cellCounts function to process a scRNAseq dataset but am encountering an error. We sequenced the same sample on two instruments:

  1. Illumina NextSeq 500 (28 + 56 nt)
  2. Illumina NovoSeq 6000 (150 + 150 nt)

The cellCounts function returns successfully when run on the FASTQ files of the NextSeq instrument (28 + 56), but throws the following memory mapping error on the NovoSeq instrument (at 150 + 150 nt):

|| Sort the 28395 genes...                                                    ||
|| Load the 1-st index block...                                               ||

 *** caught segfault ***
address (nil), cause 'memory not mapped'

ERROR: the UMI length is abnormaly long (135 bases). This can be caused by an incorrect cell barcode file.

Has anyone encountered this before or could offer advice to successfully process the NovoSeq sample?

I am including the head from each R1 and R2 file below to show the data structure of each instrument. Perhaps there is something obvious I'm missing. Thanks for your time.


NextSeq 500, R1:

@NB552224:567:HKCJKBGXV:1:11101:19095:1039 1:N:0:GTAGACGA
ACGGTNGCATTGCAACATAACTGAACCN
+
AAAAA#EEEEEEEEEEEEEEEEEAEEE#
@NB552224:567:HKCJKBGXV:1:11101:6118:1039 1:N:0:GTAGACGA
CCGATNTAGTGCAAATCTGCCCAAAGTN
+
AAAAA#EEEEEEEEEEEEEEEEEEEEE#
@NB552224:567:HKCJKBGXV:1:11101:18652:1039 1:N:0:GTAGACGA
TGAATNCAGCCTCTTCTCCCCGCCTCTN

NextSeq 500, R2:

@NB552224:567:HKCJKBGXV:1:11101:19095:1039 2:N:0:GTAGACGA
NCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCA
+
#AAAAEEA<AEEEEE<E<E/<EE/</E<6EAAEAEE<6/6AEEEEE/<EEA///6E
@NB552224:567:HKCJKBGXV:1:11101:6118:1039 2:N:0:GTAGACGA
NTACGAAATCCTCCCCACTTTTGATGTTCTGCATTTCAAATCTGAAGGGTACAACG
+
#AAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEAEAEEEEEEEEA
@NB552224:567:HKCJKBGXV:1:11101:18652:1039 2:N:0:GTAGACGA
NTGATCTCTAGTGGAGATCTCTTTGAGGGCTGTAGTACTAAAGTGTACTTAATGTT

NovoSeq 6000, R1:

@A01071:356:HTWLKDSX7:2:1101:24858:1016 1:N:0:GTAGACGAAA+NCCACACTAG
TNAATTCCAGACCTATCTTTTTACAGCCTCCCGGACGCCGATCGCCCATAGTGTTTTAGAAGTGAAAGTATATAATCCCAAATATACAGATTGAATTTGAGGGGACTATTTTGTCTGTGTGAGCCACAGAAAACACAGGTTGGTATTAAAT
+
:#,FFFFFFFFFFFF::FFFFFFFFFFF,,,,,,,,F,,,,,,:,,,F,:,F,,,,F:,,F,FF,F,,F,FF,::,,,FF:FFFF:::,:,F,:F,F,,,,::F:,F,,:,:,,,,:F,FF,,,FFFF,FF:FFF,,:,,F,,:,,,,::,
@A01071:356:HTWLKDSX7:2:1101:24876:1016 1:N:0:GTAGACGAAA+NCCACACTAG
GNACAGTAGCCAGAGTCGTACGGAAAGGGGTTTTAGGTATAAAATTTTTTTGTGTAGAAAAAAGCGGTGGTTAAATTTTGTCCAACGCTTGTTAGGTTAGTTAATAAACCTGCCTATTTGCTGTCGTGAGAGGCTTATGCAGAATCCCGAT
+
F#FFFFFFFFF,FFFFFFFFFFFF:FFF,,,,,,,,,,:,F,,,F,F,F,,,:F,,,,,F,,:F:F,,,,FF,,,F:FFFFFFFF,FF,,,::F,F,FFF:F,F:FFF,FFF,F,FFF:F,F:,,F,:,FFFFF,,,,FF,,FF,,:FF,F
@A01071:356:HTWLKDSX7:2:1101:24894:1016 1:N:0:GTAGACGAAA+NCCACACTAG
ANCCTATTCGGCGATCGTGGTCCGATGGTTATCAGGGTTTTGTTTCTGGCCCCTAACAGAGAGCCGTGCTCTGTCTCCCAGGCTGGAGTGCAGTGGCACAATCTCAGCTCACTGCACCCTCCACCTTCCGGGTTCACGCAATTTTCCTGCC

NovoSeq 6000, R2:

@A01071:356:HTWLKDSX7:2:1101:24858:1016 2:N:0:GTAGACGAAA+NCCACACTAG
TCATCTGGGAGCCTGTGCCCCTGGGTCCTCGAGGGTCATGGCTTGTCCCTGGTCAGTCCTGTCTGACTGACCTCAGGGCCTCACCTCTCTGCCCTTCCCTGCCCGGTTCCTACTCACCTGGCTAGGGCCAGTGCCCATTTTCAGCCCTACC
+
:,F::FFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFF:,FFFFFFFFFFF,:FFF:FF,F,F:FFFFFFFFFFFF:FFFF,F,FFFFFFFF,,FF
@A01071:356:HTWLKDSX7:2:1101:24876:1016 2:N:0:GTAGACGAAA+NCCACACTAG
GAAGCTTATCAAGAAGATGGGTGACCACCTGACCAACCTCCACAGGCTGGGTGGCCCGGAGGCTGGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAAGAGCCTTCTGAGCCCAGCGACTTCTGAAGGGCCCCTTGC
+
FFFFFFFFFFFFFFFF:FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFF
@A01071:356:HTWLKDSX7:2:1101:24894:1016 2:N:0:GTAGACGAAA+NCCACACTAG
GTCAAAATAGGCTGGGCGTGGTGGCTCACGCCTGTAATCCCTGCACTTTGGGAGGCCAAGGCGGGTAGATTACCTGAGGTCAGGAACTCAAGACCAGCCTGGCCAGCATGGCGAAATCCTGTCTCTACTAAAAATACAAAAATTAGCTGAG

sessionInfo()

> sessionInfo()
R version 4.3.2 (2023-10-31)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Amazon Linux 2

Matrix products: default
BLAS/LAPACK: /usr/lib64/libopenblasp-r0.3.9.so;  LAPACK version 3.9.0

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
 [3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8    
 [5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
 [9] LC_ADDRESS=C               LC_TELEPHONE=C            
[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       

time zone: UTC
tzcode source: system (glibc)

attached base packages:
[1] stats4    stats     graphics  grDevices utils     datasets  methods  
[8] base     

other attached packages:
[1] stringr_1.5.1        biomaRt_2.58.0       org.Hs.eg.db_3.18.0 
[4] AnnotationDbi_1.64.1 IRanges_2.36.0       S4Vectors_0.40.2    
[7] Biobase_2.62.0       BiocGenerics_0.48.1  Rsubread_2.16.0     

loaded via a namespace (and not attached):
 [1] rappdirs_0.3.3          utf8_1.2.4              generics_0.1.3         
 [4] xml2_1.3.6              bitops_1.0-7            RSQLite_2.3.4          
 [7] stringi_1.8.3           lattice_0.22-5          hms_1.1.3              
[10] digest_0.6.34           magrittr_2.0.3          grid_4.3.2             
[13] fastmap_1.1.1           blob_1.2.4              Matrix_1.6-5           
[16] progress_1.2.3          GenomeInfoDb_1.38.5     DBI_1.2.1              
[19] httr_1.4.7              fansi_1.0.6             XML_3.99-0.16          
[22] Biostrings_2.70.1       cli_3.6.2               rlang_1.1.3            
[25] crayon_1.5.2            dbplyr_2.4.0            XVector_0.42.0         
[28] bit64_4.0.5             cachem_1.0.8            tools_4.3.2            
[31] memoise_2.0.1           dplyr_1.1.4             filelock_1.0.3         
[34] GenomeInfoDbData_1.2.11 curl_5.2.0              vctrs_0.6.5            
[37] R6_2.5.1                png_0.1-8               lifecycle_1.0.4        
[40] BiocFileCache_2.10.1    zlibbioc_1.48.0         KEGGREST_1.42.0        
[43] bit_4.0.5               pkgconfig_2.0.3         pillar_1.9.0           
[46] glue_1.7.0              tibble_3.2.1            tidyselect_1.2.0       
[49] compiler_4.3.2          prettyunits_1.2.0       RCurl_1.98-1.14
Rsubread • 363 views
ADD COMMENT
0
Entering edit mode

Can you provide more information about chemistry / protocol used for generating the data that had the error? We are wondering if it was from 3' or 5' gene expression sequencing, or some other sequencing protocols from 10x.

It will be very helpful if you can also provide a few tens of thousands of reads in both R1 and R2 fastq.gz files. This can help us to figure out the type of data and do some tests.

ADD REPLY

Login before adding your answer.

Traffic: 405 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6